§ 1. Endamálið við
This presentation is the property of its rightful owner.
Sponsored Links
1 / 17

§ 1. Endamálið við ílegulógini er : 1 ) at verja einstaklingin í sambandi við ílegugransking PowerPoint PPT Presentation


  • 78 Views
  • Uploaded on
  • Presentation posted in: General

§ 1. Endamálið við ílegulógini er : 1 ) at verja einstaklingin í sambandi við ílegugransking 2 ) at skapa fortreytir fyri og stimbra gransking í mannaílegum í Føroyum , soleiðis at slík gransking kann vera við til at : a . menna førleikan at lekja og fyribyrgja sjúkum

Download Presentation

§ 1. Endamálið við ílegulógini er : 1 ) at verja einstaklingin í sambandi við ílegugransking

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


§ 1. Endamálið við ílegulóginier:

1) at verja einstaklingin í sambandi við ílegugransking

2) at skapa fortreytir fyri og stimbra gransking í mannaílegum í Føroyum, soleiðis at slík gransking kann vera við til at:

a. menna førleikan at lekja og fyribyrgja sjúkum

b. menna almennu heilsutænastuna

c. menna granskingarumhvørvið


FarGen

Heilgenomsekventera allar føroyingar, UTTAN at arvastrongurin

(í fyrsta umfari) verður analysaraður

TGGAAGTGTTTGCTACCAAGTTTATTTGCAGTGTTAACAGCA

CAACATTTACAAAACGTATTTTGTACAATCAAGTCTTCACTGC

CCTTGCACACTGGGGGGGCTAGGGAAGACCTAGTCCTTCCA

ACAGCTATAAACAGTCCTGGATAATGGGTTTATGAAAAACAC

TTTTTCTTCCTTCAGCAAGCAAAATTATTTATGAAGCTGTATG

GTTTCAGCAACAGGGAGCAAAGGAAAAAAATCACCTCAAAG

AAAGCAACAGCTTCCTTCCTGGTGGGATCTGTCATTTTATAG

ATATGAAATATTCATGCCAGAGGTCTTATATTTTAAGAGGAAT


Ílegusavnið

Vevnaðarskrá

Fargen – heilgenomsekventring (ACTGACTG)

GranskingHeilsuverkið


Fargen– heilgenomsekventring (ACTGACTG)

Granskingarverkætlanir

Data verður tulkað

  • loyvi frá Siðsemisnevndini, Dátueftirlitinum og Ílegusavninum

  • Hvør einstakur - sum hevur givið loyvi til tess - verður kontaktaður við umbøn um at luttaka í granskingarverkætlan – informerað samtykki


Etikkur/trygd

  • Ílegugransking fyrigongur í dag

  • Við Fargen - undir føroyskum ræði

  • Afturmelding um álvarslig fund – bert tað man kann gera fyribyrgja/viðgerða - annars eingin luttøka

  • Granskingarverkætlanar hyggja bert eftir tí sum er endamálið

  • Fólk hava ofta longu frammanundan varhuga av hvørjar sjúkur eru í teirra familju

  • Fylgja øllum lógarkarmum

  • Uppískoyti til tryggingarlóggávu


Hvat fáa vit burturúr Granskingarpartinum

  • Menna heilsugransking í Føroyum

  • Stýra og skipa ílegugransking í Føroyum

  • Skapa arbeiðspláss og førleikar – byggja land

  • Skapa karmar fyri at kunna søkja stórar útlendskar granskingarpuljur

  • Kunnu bjóða meira og tí krevja meira

  • Fiskivinnugransking


Ílegusavnið

Vevnaðarskrá

Fargen – heilgenomsekventring (ACTGACTG)

Gransking Heilsuverkið


Heilsuverkið

Læknin biður um at relevant genhjá einum sjúklingi verða analyserað um læknin metir at grund er til tess


  • LS metir, at tað kundi verið áhugavert at viðvirka enn meiri undir gransking í Føroyum av samspælinum millum arv, umhvørvi og sjúku. Umhvørvið er ein samanseting av viðurskiftum, sum mennisku lutvíst kunnu ávirka og lutvíst ikki. Í hesum sambandi er FarGen-verkætlanini serlig og hevur sera stórt potentialið fyri framtíðar fyribyrging og ráðlegging av heilsuátøkum.


Facilitetir

Ílegugransking fyrigongur longu í Føroyum

  • Ílegusavn – taka blóðroyndir – isolera DNA

  • iNova – kann húsa sekventeringmaskinum

  • Ílegusavnið kann hýsa sekventeringsúrslitum

  • LS hevur útvega hýsingarkapasitet

  • Ættarbandsskrá, diagnosuskrá og vevnaðarskrá

  • Samstarv millum Setrið og Oxford Universitetið um upplæring í at tulka sekventeringsúrslitini (bioinformatik)


Samstarv


Studentaskúlanæmingar


EBI roadshownov 2012 og juni 2013

Juni 2013 genetik fyri læknar


  • Prógva áhuga fyri FarGen

  • Bygt upp altjóða samstarv

  • Bygt upp innlendis samstarv

  • Víst á møguleikar - alment og PPP

  • Stóran altjóða áhuga

  • Katalysator

  • Skal í gongd – Vilja tit hetta?


  • Login