Computational biology of diabetes mellitus
This presentation is the property of its rightful owner.
Sponsored Links
1 / 75

Computational Biology of diabetes mellitus PowerPoint PPT Presentation


  • 66 Views
  • Uploaded on
  • Presentation posted in: General

Computational Biology of diabetes mellitus. Allam Appa Rao JNTU Kakinada Kakinada 533 003. IT in Health Care: New Trends and Technologies RMC, Kakinada 18 th April 2010. information. ‘In-formation’ is a word derived from a latin word ‘Informare’,

Download Presentation

Computational Biology of diabetes mellitus

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Computational biology of diabetes mellitus

Computational Biology of diabetes mellitus

Allam Appa Rao

JNTU Kakinada

Kakinada 533 003

IT in Health Care: New Trends and Technologies

RMC, Kakinada

18th April 2010

Allam Appa Rao


Information

information

‘In-formation’ is a word derived from a latin word ‘Informare’,

which means to put it into from or in-formation.

Another meaning is ‘to give form to the mind’

Allam Appa Rao


Philosophy of information

Philosophy of Information

Philosophy of information (PI) is the area of research that studies conceptual issues arising at the intersection of computer science, information technology, and philosophy

Allam Appa Rao


My interest

My interest

My interest is the investigation of the conceptual nature and basic principles of information, includes its dynamics, utilisation and sciences & elaboration and application of information-theoretic and computational methodologies to problems

Allam Appa Rao


Computational biology of diabetes mellitus

JNTU-K VISION

“Attaining new heights in research by shaping IT as a premier precision tool for the welfare of the poor”.


Richard dawkins university of california berkeley oxford university

Richard Dawkins University of California, Berkeley & Oxford University

If you want to understand life, don't think about vibrant, throbbing gels .. think about information technology (IT).

Allam Appa Rao


Computational biology of diabetes mellitus

HGP

Recent human genome breakthrough is the result from the work of multi-disciplinary teams where cooperation from computer experts was a fundamental ingredient.

Allam Appa Rao


Cells as information systems

Cells as Information Systems

Cells and cellular systems require viewing them as information processing systems, as evidenced by the fundamental similarity between molecular machines of the living cell and computational automata, and by the natural fit between computer process algebras and biological signaling and between computational logical circuits and regulatory systems in the cell

AllamAppaRao


Our research

Our Research

Our research work is influenced by our fascination about the mysteries that remain in the catalogue of human genes.

I believe that a systematic approach to the acquisition, management, and analysis of information available in human genes and their study can greatly enhance the quality and efficiency of medicines

Allam Appa Rao


Computational biology of diabetes mellitus

Socrates taught us, the essence of Scienceis measuring, counting, and weighing together with reasoning from postulates or axioms

Dijkstra

"Computer Science is no more about computers than astronomy is about telescopes http://www.quotationspage.com/quote/788.html”

Knuth

“Science is what we understand well enough to explain to a computer”

If you want to understand life, don't think about vibrant, throbbing gels and oozes, think about information technology. --- Richard Dawkins, University of California, BerkeleyOxford UniversityThe Blind Watchmaker, 1986, Norton, p. 112.

Allam Appa Rao


The value of the right tool

The Value of the Right Tool

A “Supercomputer” Cluster

3.2 Billion Nucleotides


Paradigm of computational thinking

Paradigm of 'computational thinking'

Advances in computational power and computational methods have led to the crystallization of the paradigm of 'computational thinking’

Allam Appa Rao


Paradigm of computational thinking1

Paradigm of 'computational thinking‘ ……

This paradigm of 'computational thinking‘ takes applications of computer science far beyond mere programming and data management.

Allam Appa Rao


Paradigm of computational thinking2

Paradigm of 'computational thinking‘ ……

  • This paradigm of 'computational thinking’ provides newer methods for understanding the complex life style diseases like Diabetes.

Allam Appa Rao


Computational biology of diabetes mellitus

http://www.ygyh.org/index.htm

Allam Appa Rao


Computational biology of diabetes mellitus

IT

Information technology (IT) is "the study, design, development, implementation, support or management of computer-based information systems, particularly software applications and computer hardware", according to the Information Technology Association of America (ITAA)

IT deals with the use of electronic computers and computer software to convert, store, protect, process, transmit, and securelyretrieveinformation.

Allam Appa Rao


Computational biology of diabetes mellitus

IT…..

Information technology is a general term that describes any technology that helps to produce, manipulate, store, communicate, and/or disseminate information.

Allam Appa Rao


Computational biology of diabetes mellitus

IT

Over the past few decades rapid developments in molecular research technologies (MRT) and developments in information technologies (IT) have combined to produce a tremendous amount of information

Allam Appa Rao


Watson crick

Watson & Crick

Raising their glasses in the Eagle, a pub near the campus of Cambridge University in England, a euphoric Francis Crick, 36, and James Waston, 24, drank to what they had just accomplished. Over the hubbub in the crowded pub. Crick’s voice boomed out, “We have discovered the secret of life!”

Allam Appa Rao


Anything computable

Anything Computable!

  • Markov defined what became known as Markov algorithms (HMM) for chemical computation

  • Alonzo Church used Lambda calculus for computing

  • Kurt Gödel defined Recursive functions

Allam Appa Rao


Computational biology of diabetes mellitus

Information Theory, Evolution, and the Origin of Life

Hubert P. Yockey, pp 35

Allam Appa Rao


Computational biology definition

Computational Biology: Definition

http://en.wikipedia.org/w/index.php?title=Computational_biology&oldid=128766842

Computational biology is a field that applies the techniques of computer science to address problems of biology.

Allam Appa Rao


Bioinformatics

Bioinformatics

Allam Appa Rao


Bioinformatics definition

Bioinformatics: Definition

Bioinformatics is the application of information technology and computer science to the field of molecular biology.

The term bioinformatics was coined by Paulien Hogeweg in 1979 for the study of informatic processes in biotic systems.

Allam Appa Rao


Bioinformatics entailment

Bioinformatics: Entailment

Bioinformatics entails the creation and advancement of databases, algorithms, computational and statistical techniques, and theory to solve formal and practical problems arising from the management and analysis of biological data.

Allam Appa Rao


Bioinformatics activities

Bioinformatics: Activities

Common activities in bioinformatics include mapping and analyzing DNA and protein sequences, aligning different DNA and protein sequences to compare them and creating and viewing 3-D models of protein structures.

Allam Appa Rao


Bioinformatics research

Bioinformatics: Research

Major research efforts in the field include sequence alignment, gene finding, genome assembly, protein structure alignment, protein structure prediction, prediction of gene expression and protein-protein interactions, genome-wide association studies and the modelling of evolution.

Allam Appa Rao


Bioinformatics applications

Bioinformatics: Applications

Bioinformatics focuses on developing and applying computationally intensive techniques like pattern recognition, data mining, machine learning algorithms, and visualization

Allam Appa Rao


Dm definition

DM: Definition

Diabetes Mellitus is a condition in which the body either does not produce enough, or does not properly respond to, insulin, a hormone produced in the pancreas.

Allam Appa Rao


Dm epidemic

DM: Epidemic

Diabetes Mellitus (DM) affects about 10-15% of the Indians and is assuming epidemic proportions, development of newer robust therapeutic approaches both in its prevention and treatment are needed.

Allam Appa Rao


Computational biology of diabetes mellitus

Possible Future Treatment for Diabeteshttp://www.nature.com/nature/journal/vaop/ncurrent/pdf/nature08894.pdf

  • Insulin, a hormone produced by the pancreas, signals cells to remove glucose from the blood and store it as glycogen. Glucagon is a protein also produced by cells in the pancreas but it has the opposite effect of insulin. When blood glucose levels are low, glucagon causes the breakdown of glycogen into glucose that is then released into the blood. The insulin is made in beta cells, where as the glucagon is made in alpha cells. In patients with type 1 diabetes, the immune system attacks the beta cells, eliminating insulin production.

Allam Appa Rao


Possible future treatment for diabetes

Possible Future Treatment for Diabetes....

Scientists from the University of Geneva have shown that alpha cells in the pancreas of mice have changed to insulin producing beta cells. In the study, approximately 5 % of the alpha cells became beta cells. The response seen only occurs in mice when the majority of the beta cells have been eliminated.

Allam Appa Rao


Possible future treatment for diabetes1

Possible Future Treatment for Diabetes.....

If we can find a way to encourage human cells to transform in a similar way while preventing the immune system from destroying the new cells, even a small percentage of new beta cells could make a huge difference in the life of a diabetic. Identification of the mechanisms that transform alpha cells into beta cells will not only help in the treatment of diabetes but can reveal insights into the ability to direct changes in other cells, including cancer.

Allam Appa Rao


Our work bdnf

Our Work: BDNF

  • BDNF is a natural compound that is present in human body and hence therapeutics developed using these molecules are expected to have fewer side effects.

  • BDNF can indeed prevent and ameliorate DM, it would pave way to develop newer therapeutic opportunities.

  • BDNF as a therapeutic tool for the prevention and treatment of DM.

Allam Appa Rao


Computational biology of diabetes mellitus

Allam Appa Rao


Protein folding

Protein folding ?

The ability of a protein to fold reliably into a pre-determined conformation despite a near infinite number of possibilities is, despite much research, still poorly understood.

The structure of a protein is determined purely by the amino acid sequence, and the structure of the protein determines the function.

The function of a protein depends entirely on the ability of the protein to fold rapidly and reliably to its native structure. Many proteins fold spontaneously into their native structure in aqueous solution.

It has been suggested that for a protein of 100 amino acids, a purely random conformational search would require around 10 **29 years, and yet proteins are able to fold on a timescale of milliseconds to seconds.

This suggests that only a small amount of conformational space is sampled during the folding process and this in turn implies the existence of kinetic folding pathways.

This paradox of how proteins fold rapidly and reliably to their native conformation is known as the protein folding problem.

Allam Appa Rao


Statistics is essence of making sense

Statistics is essence of making sense

Allam Appa Rao


George gamow 1904 68

George Gamow (1904-68)

Application of Shannon’s information theory breaks genetics and molecular biology out of the descriptive mode into the quantitative mode

Allam Appa Rao


Shannon information flow

Shannon - Information Flow

  • Information flow in an information theoretical context is the transfer of information from a variableh to a variable l in a given process.

  • The measure of information flow, p

  • P is defined as the uncertainty before the processstarted minus the uncertainty after the process terminated. This can be quantified as

  • where H (h | l) is the conditional entropy (equivocation) of variable h (before the process started) given the variable l (before the process started), and H(h | l') is the conditional entropy (equivocation) of variable h (before the process started) given the variable l' (the value of variable l after the process finished).

  • H(X,Y) is the joint entropy, and can be calculated as follows:

Gene

Protein

Allam Appa Rao


Information in living organisms

Information in living organisms

One of the prime characteristics of all living organisms is the information they contain for all operational processes

  • Braitenberg, a German cybernetist, has submitted evidence ‘that information is an intrinsic part of the essential nature of life.’ The transmission of information plays a fundamental role in everything that lives.

  • Without a doubt, the most complex information processing system in existence is the human body. If we take all human information processes together, that is, conscious ones (language, information-controlled functions of the organs, hormone system), this involves the processing of 1024 bits daily.

  • This astronomically high figure is higher by a factor of 1,000,000 than the total human knowledge of 1018 bits stored in all the world’s libraries.

Allam Appa Rao


Allen turing and gatlinburg symposium on information theory in biology

Allen Turing and Gatlinburg symposium on information theory in biology

The logic of Turing machines has an isomorphism with the logic of the genetic information system

  • Information Source

  • Transmission of Information

  • Tasks to be completed

  • Output

  • Information source: DNA

  • Transmission through m/t/r RNA

  • Tasks: Transcription, translation

  • Output: Protein(s)

Allam Appa Rao


Computational biology of diabetes mellitus

Information Theory, Evolution, and the Origin of Life

Hubert P. Yockey, pp 35

Allam Appa Rao


Shannon turing gamow and rao

Shannon, Turing, Gamow and Rao

H (gene) L (protein)

Information

Transfer

Process

Allam Appa Rao


The word information derives from the latin informare which means to put into form

The word "information" derives from the Latin, informare, which means "to put into form”

Latent

Manifest

Readily seen, or understood:

apparent, clear, evident, noticeable, observable

  • Existing or present

  • but concealed or inactive

DNA

Protein

Allam Appa Rao


How does the code work

How does the code work?

Inherited disease: broken/ damaged dna  broken/ damaged proteins

Viral disease: dna/rna  foreign proteins (Akin to Computer VIRUS)

  • Template for construction of proteins

Manifestation

Latent Information

Manifested

Information

Allam Appa Rao


Genomic information

Genomic Information

ACGTCCGGCCTTATACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAG…

What good is all this genetic information?

Allam Appa Rao


Information inheritance

Information Inheritance

  • Human beings are endowed with the information encoded in the genetic material of inheritance which controls the development, reproduction and self-repair.

  • The carrier of this information is a complex structure of dna.

Allam Appa Rao


Anything computable1

Anything Computable!

  • Markov defined what became known as Markov algorithms (HMM) for biological computation

  • Alonzo Church used Lambda calculus for computing

  • Kurt Gödel defined Recursive functions

Allam Appa Rao


Genetic information flow

Genetic Information Flow

  • Within the body, genetic information flows from dna to protein and other products

  • first, by the transcription of portions of the dna into so-called messenger rna and,

  • second, by (translation) the assembly of individual amino acids into polypeptides, including proteins.

This is the process of life and living related to information flow.

Allam Appa Rao


The new challenges in computer science

The new Challenges in Computer Science

  • Promoter recognition in genomic sequence,

  • Understanding data from micro array experiments, and

  • Accurate prediction of protein folds from sequences

Allam Appa Rao


Computational biology of diabetes mellitus

OVERVIEW


Computational biology of diabetes mellitus

Bioinformatics approach to extract

information from genes

  • With the widespread availability of nucleotide and amino acid sequences, novel methods for extracting biologically and clinically relevant knowledge are feasible.

  • Data is deposited on the Internet on websites such as GeneCards, available at http://www.genecards.org/mirror.shtml .

  • Further information can be obtained from related sites - UniProt (http://www.uniprot.org) and SwissProt (http://www.expasy.org/sprot/).

  • Using FASTA and CLUSTAL_X programs, similarity scores can be calculated to choose items of interest.

  • Further information can be obtained by mining text, either manually or increasingly using text-mining tools such as PathBinderH and GENIA corpus.


Computational biology of diabetes mellitus

METHODS AND PROCEDURES


Computational biology of diabetes mellitus

Computational approach of protein analysis using affinity chromatography: application to proteomics

  • Computerization is necessary to build the database of chromatography coupled mass spectrometric analytical data.

  • On the basis of this proteomic data we can identify the proteins as biomarkers which are expressing dissimilarity between healthy and disease condition.

  • Affinity chromatography is one of the fastest liquid chromatographic methods for the separation and purification of biomolecules due to its high molecular specificity.

  • Proteomics and tools for identification and understanding the biochemistry of proteins and pathways are in a new stage of development and evaluation.


Computational biology of diabetes mellitus

Development and Validation of LC Method for the Determination of Famciclovir in Pharmaceutical Formulation Using an Experimental Design

  • A rapid and sensitive RP-HPLC method with UV detection (242 nm) for routine analysis of famciclovir in pharmaceutical formulations was developed.

  • Chromatography was performed with mobile phase containing a mixture of methanol and phosphate buffer (50:50, v/v) with flow rate 1.0 mL min−1.

  • Quantitation was accomplished with internal standard method. The procedure was validated for linearity (correlation coefficient =0.9999), accuracy, robustness and intermediate precision.

  • Experimental design was used for validation of robustness and intermediate precision.

  • Contd…


Computational biology of diabetes mellitus

  • To test robustness, three factors were considered; percentage v/v of methanol in mobile phase, flow rate and pH; flow rate, the percentage of organic modifier and pH have considerable important effect on the response.

  • For intermediate precision measure the variables considered were: analyst, equipment and number of days. The RSD value (0.86%, n=24) indicated an acceptable precision of the analytical method.

  • The proposed method was simple, sensitive, precise, accurate and quick and useful for routine quality control.


Computational biology of diabetes mellitus

Mathematical Analysis of Diabetes Related Proteins Having High Sequence Complexity

  • We have searched for proteins affecting diabetes and we also found in which common species these proteins were more prevalent and have performed protein composition analysis of those having high sequence complexity.

  • About 90% of rat genes have counterparts in the mouse and human genomes and this is the reason to find proteins common among the three different species.(Rat Genome Sequencing Consortium 2004, www.ratbehaviour.org/Ratsmice.htm)

  • The distribution pattern of the protein variates was examined and bivariate plots were further drawn.

  • Contd…


Computational biology of diabetes mellitus

  • The bivariate plots show a similar clustering for Rattus norvegicus and Mus Musculus but show some variation in Homo sapiens indicating that the plots are correct as Rattus Norvegicus and Mus Musculus are relatively close in the phylogenetic tree(Sridhar GR etal) hence having a similar clustering.

  • The proteins which are away from the cluster are outliers due to the reason that they are having different compositional characteristics.


Computational biology of diabetes mellitus

PHYLOGENETIC TREES:

DIABETIC COMPLICATIONS

AND RELATED CONDITIONS


Computational biology of diabetes mellitus

Bioinformatics analysis of diabetic retinopathy using functional protein sequences

  • Diabetic retinopathy is the leading cause of blindness among patients with diabetes mellitus.

  • We evaluated the role of several proteins that are likely to be involved in diabetic retinopathy by employing multiple sequence alignment using ClustalW tool and constructed a phylogram tree using functional protein sequences extracted from NCBI.

  • Phylogram was constructed using Neighbor-Joining Algorithm in bioinformatics approach.

  • It was observed that aldose reductase and nitric oxide synthase are closely associated with diabetic retinopathy.

  • Contd…


Computational biology of diabetes mellitus

  • It is likely that vascular endothelial growth factor, pro-inflammatory cytokines, advanced glycation end products, and adhesion molecules that also play a role in diabetic retinopathy may do so by modulating the activities of aldose reductase and nitric oxide synthase.

  • These results imply that methods designed to normalize aldose reductase and nitric oxide synthase activities could be of significant benefit in the prevention and treatment of diabetic retinopathy.


Computational biology of diabetes mellitus

COMPUTATIONAL PROTEIN SEQUENCES ANALYSIS FOR DIABETIC RETINOPATHY – A BIO INFORMATICS STUDY

  • The role of bioinformatics is to aid life scientists in gathering and processing genomic data to study protein function.

  • Another important role is to aid researchers at pharmaceutical companies in making detailed studies of protein structures to facilitate drug design.

  • Human genome with 3 billion chemical nucleotide bases has about 30,000 genes whose functions are known to a great extent.

  • These genes dictate the synthesis of different proteins which proteins differ from one another in their amino acid sequence.

  • The physiological functions of a protein depend upon this sequence.

  • Contd…


Computational biology of diabetes mellitus

  • The functions of the protein, butyrylcholinesterase, are not known to a great extent.

  • Therefore its amino acid sequence is compared with the sequences of 29 different proteins using computational techniques.

  • Close similarity is observed with the protein EST2_human which confirms similarities of physiological actions.

  • This finding obtained from computational techniques, now found to be indispensable, help the scientists of life sciences to proceed with the work in their wet laboratories.

  • Contd…


  • Computational biology of diabetes mellitus

    • Amino acid sequence of BChE is compared with proteins which act as inhibitors of neovascularisation and similarity is found with one of the inhibitors. Early onset of diabetic retinopathy is often found in patients who have insufficient BChE in their serum.

    • This suggests that BChE may act as an inhibitor of neovascularisation that causes retinopathy.


    Computational biology of diabetes mellitus

    Bioinformatics analysis of functional protein sequences reveals a role for brain-derived neurotrophic factor in obesity and type 2 diabetes mellitus

    • Using bioinformatics techniques and sequence analyses algorithms, a comparative study between human and rodents revealed similarity in the behavior of genes involved in the control of energy homeostasis.

    • Brain-derived neurotrophic factor (BDNF) modulates the secretion and actions of insulin, leptin, ghrelin, various neurotransmitters and peptides, and pro-inflammatory cytokines involved in energy homeostasis suggesting that it (BDNF) has a significant role in the pathobiology of obesity and type 2 diabetes mellitus.

    • Contd…


    Computational biology of diabetes mellitus

    • Based on these evidences, we propose that obesity and type 2 diabetes could be disorders of the brain and BDNF could serve as a biomarker in predicting their development.

    • Hence, methods developed to selectively deliver BDNF to appropriate hypothalamic neurons may form a novel approach in their treatment.


    Computational biology of diabetes mellitus

    Bioinformatics Analysis of Functional Protein Sequences Reveals a Role for Tumor Necrosis Factor-α and Nitric Oxide in Insulin Resistance Syndrome

    • Using bioinformatics techniques and sequence analyses algorithms, we identified that tumor necrosis factor-α (TNF-α) and nitric oxide (NO) have a significant role in the pathobiology of insulin resistance syndrome, a condition that is common in subjects with abdominal obesity, hypertension, dyslipidemia, atherosclerosis, and coronary heart disease and are accompanied by endothelial dysfunction due to reduced endothelial nitric oxide generation.

    • TNF-α has neurotoxic actions, stimulates inducible NO synthase activity, and modulates the expression of neurotransmitters involved in the control of feeding and thermogenesis.

    • Contd…


    Computational biology of diabetes mellitus

    • NO is a neurotransmitter and influences secretion and actions of various hypothalamic peptides and neuropeptides.

    • Insulin suppresses the production of TNF-α but stimulates that of endothelial NO.

    • This close interaction between TNF-α, NO, hypothalamic peptides, and insulin suggests that regulation of TNF-α and NO production and action could be critical in the management of insulin resistance syndrome and its associated conditions.


    Computational biology of diabetes mellitus

    BUTYRLCHOLINESTERASE


    Computational biology of diabetes mellitus

    Phylogenetic Tree Construction of Butyrylcholinesterase Sequences in Life Forms

    • Butyrylcholinesterase is an enzyme with few known physiological functions. It is related to acetylcholine that was shown to be expressed in a variety of life forms.

    • We performed a search using the human butyrylcholinesterase gene (HGNC:983;MIM:177400), and found the sequence in a broad spectrum including plants, bacteria and animals.

    • Therefore butyrylcholinesterase appears to have evolved early in evolution,

    • and to have been conserved.


    Computational biology of diabetes mellitus

    Serum butyrylcholinesterase in type 2 diabetes mellitus: a biochemical and bioinformatics approach

    Background

    Butyrylcholinesterase is an enzyme that may serve as a marker of metabolic syndrome. We (a) measured its level in persons with diabetes mellitus, (b) constructed a family tree of the enzyme using nucleotide sequences downloaded from NCBI. Butyrylcholinesterase was estimated colorimetrically using a commercially available kit (Randox Lab, UK). Phylogenetic trees were constructed by distance method (Fitch and Margoliash method) and by maximum parsimony method.

    Contd…


    Computational biology of diabetes mellitus

    Results

    There was a negative correlation between serum total cholesterol and butyrylcholinesterase (-0.407; p < 0.05) and between serum LDL cholesterol and butyrylcholinesterase (-0.435; p < 0.05). There was no statistically significant correlation among the other biochemical parameters. In the evolutionary tree construction both methods gave similar trees, except for an inversion in the position of Sus scrofa (M62778) and Oryctolagus cuniculus (M62779) between Fitch and Margoliash, and maximum parsimony methods.

    Conclusion

    The level of butyrylcholinesterase enzyme was inversely related to serum cholesterol; dendrogram showed that the structures from evolutionarily close species were placed near each other.


    Computational biology of diabetes mellitus

    Alzheimer's disease and Type 2 diabetes mellitus: the cholinesterase connection?

    • Alzheimer's disease and type 2 diabetes mellitus tend to occur together.

    • We sought to identify protein(s) common to both conditions that could suggest a possible unifying pathogenic role. Using human neuronal butyrylcholinesterase (AAH08396.1) as the reference protein we used BLAST Tool for protein to protein comparison in humans. We found three groups of sequences among a series of 12, with an E-value between 0–12, common to both Alzheimer's disease and diabetes: butyrylcholinesterase precursor K allele (NP_000046.1), acetylcholinesterase isoform E4-E6 precursor (NP_000656.1), and apoptosis-related acetylcholinesterase (1B41|A).

    • Contd…


    Computational biology of diabetes mellitus

    • Butyrylcholinesterase and acetylcholinesterase related proteins were found common to both Alzheimer's disease and diabetes; they may play an etiological role via influencing insulin resistanceand lipid metabolism.


  • Login