Vicki
Download
1 / 8

Vicki & Joe - PowerPoint PPT Presentation


  • 134 Views
  • Uploaded on

Vicki & Joe. Bioinformatics DNA -> RNA-> Protein Codons 64 Different Codons Replication -> Transcription -> Translation Sequence Alignment. DNA: AGTCTCGTTACTTCTTCAAAT RNA: AGUCUCGUUACUUCUUCAAAU Codons: AGU CUC GUU ACU UCU UCA AAU Protein: SLVTFLN AGU - serine - S- ser

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Vicki & Joe' - sarah


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

Vicki

&

Joe


  • Bioinformatics

  • DNA -> RNA-> Protein

  • Codons

    • 64 Different Codons

  • Replication -> Transcription -> Translation

  • Sequence Alignment


  • DNA: AGTCTCGTTACTTCTTCAAAT

  • RNA: AGUCUCGUUACUUCUUCAAAU

  • Codons: AGU CUC GUU ACU UCU UCA AAU

  • Protein: SLVTFLN

    AGU - serine - S- ser

    CUG - leucine - L - leu

    GUU - valine - V - val

    ACU - threonine - T - thr

    UCU - phenylalanine - F - phe

    UCA - leucine - L - leu

    AAU - asparagine - N - asn



  • Input: DNA Sequence

    • “1921 attttataga aaaatctctt”

  • Cleans The String

    • attttatagaaaaatctctt

  • Searches:

    • TTA, CTA, or TCA (Start Codons)‏

    • CAT (End Codon)‏

    • Checks Size (Pseudogene, Potential Gene)‏

  • Output:

    • Potenial Gene String


  • DNA-RNA-Protein

    • Nobelprize.org

  • Genetic Home Reference

    • ghr.nlm.nih.gov

  • A Science Primer

    • ncbi.nlm.nih.gov

  • Computer science and bioinformatics

    • Communications of the ACM

      • Volume 48 ,  Issue 3  (March 2005)‏


Quiz

1. How many chemical bases are in a codon?

2. What is one starting codon and the end codon?

3. How Many Different Codons are there?

4. How many amino acids are there?


ad