slide1
Download
Skip this Video
Download Presentation
Vicki & Joe

Loading in 2 Seconds...

play fullscreen
1 / 8

Vicki & Joe - PowerPoint PPT Presentation


  • 142 Views
  • Uploaded on

Vicki & Joe. Bioinformatics DNA -> RNA-> Protein Codons 64 Different Codons Replication -> Transcription -> Translation Sequence Alignment. DNA: AGTCTCGTTACTTCTTCAAAT RNA: AGUCUCGUUACUUCUUCAAAU Codons: AGU CUC GUU ACU UCU UCA AAU Protein: SLVTFLN AGU - serine - S- ser

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Vicki & Joe' - sarah


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1

Vicki

&

Joe

slide2

Bioinformatics

  • DNA -> RNA-> Protein
  • Codons
    • 64 Different Codons
  • Replication -> Transcription -> Translation
  • Sequence Alignment
slide3

DNA: AGTCTCGTTACTTCTTCAAAT

  • RNA: AGUCUCGUUACUUCUUCAAAU
  • Codons: AGU CUC GUU ACU UCU UCA AAU
  • Protein: SLVTFLN

AGU - serine - S- ser

CUG - leucine - L - leu

GUU - valine - V - val

ACU - threonine - T - thr

UCU - phenylalanine - F - phe

UCA - leucine - L - leu

AAU - asparagine - N - asn

slide5

Simple comparison between sequences

    • Matches
    • Mutations
      • Different Letters In Both Rows
    • Insertion
      • Space In Top Row
    • Deletion
      • Space In Bottom Row
slide6

Input: DNA Sequence

    • “1921 attttataga aaaatctctt”
  • Cleans The String
    • attttatagaaaaatctctt
  • Searches:
    • TTA, CTA, or TCA (Start Codons)‏
    • CAT (End Codon)‏
    • Checks Size (Pseudogene, Potential Gene)‏
  • Output:
    • Potenial Gene String
slide7

DNA-RNA-Protein

    • Nobelprize.org
  • Genetic Home Reference
    • ghr.nlm.nih.gov
  • A Science Primer
    • ncbi.nlm.nih.gov
  • Computer science and bioinformatics
    • Communications of the ACM
      • Volume 48 ,  Issue 3  (March 2005)‏
slide8
Quiz

1. How many chemical bases are in a codon?

2. What is one starting codon and the end codon?

3. How Many Different Codons are there?

4. How many amino acids are there?

ad