background session 2 transcription genetic code translation may 17 2008
Download
Skip this Video
Download Presentation
Background Session #2 Transcription Genetic Code Translation May 17, 2008

Loading in 2 Seconds...

play fullscreen
1 / 23

Background Session #2 Transcription Genetic Code Translation May 17, 2008 - PowerPoint PPT Presentation


  • 132 Views
  • Uploaded on

Background Session #2 Transcription Genetic Code Translation May 17, 2008. Henrik Kibak Associate Professor of Biology California State University, Monterey Bay. Transcription & Translation. DNA  RNA  Protein. Transcription & Translation. Review of Transcription.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Background Session #2 Transcription Genetic Code Translation May 17, 2008' - sandro


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
background session 2 transcription genetic code translation may 17 2008

Background Session #2Transcription Genetic Code TranslationMay 17, 2008

Henrik Kibak

Associate Professor of Biology

California State University, Monterey Bay

transcription translation
Transcription & Translation

DNA RNA  Protein

May 17th Workshop

review of transcription
Review of Transcription

May 17th Workshop

review of transcription1
Review of Transcription

(Prokaryotes)

May 17th Workshop

review of transcription2
Review of Transcription

May 17th Workshop

review of transcription3
Review of Transcription

Genes and RNA transcripts differ in length!

May 17th Workshop

review of transcription4
Review of Transcription

May 17th Workshop

review of translation
Review of Translation

May 17th Workshop

review of translation1
Review of Translation

May 17th Workshop

review of genetic code
Review of Genetic Code

May 17th Workshop

amino acid review
Amino Acid Review

Two of the most important properties of amino acids are their size and “hydrophobicity,” or oilyness. The more hydrophobic a residue, the more hydrogen-bond forming molecules such as water force the residue away.

This causes proteins to fold with their non-polar residues in, away from water… or to become embedded in the lipid bilayer of cell membranes.

May 17th Workshop

review of genetic code1
Review of Genetic Code

May 17th Workshop

review of genetic code2
Review of Genetic Code

May 17th Workshop

dna and protein sequences
DNA and Protein Sequences
  • ATGGAACTTATTAAAGAAGATAATGCT

May 17th Workshop

dna and protein sequences1
DNA and Protein Sequences
  • ATGGAACTTATTAAAGAAGATAATGCT

M E L I K E D N A

May 17th Workshop

dna and protein sequences2
DNA and Protein Sequences

M E L I K E D N A

ATGGAACTTATTAAAGAAGATAATGCT

ATGGAGTTCATCAAGGAGGACAACGCC

ATGGAGTTAATAAAAGAAGATAATGCA

ATGGAGTTGATTAAAGAAGATAATGCG

Met Glu Leu Ile Lys Glu Asp Asn Ala

M E L I K E D N A

ATG GAA CTT ATT AAA GAA GAT AAT GCT

G T C C G G C C C

A A A

G G

May 17th Workshop

review of genetic code3
Review of Genetic Code

May 17th Workshop

mrna protein
mRNA  Protein

HumanCytochrome c mRNA Translated to Protein

M G D V E K G K K I F I M K C S Q C H T

AUG GGU GAU GUU GAG AAA GGC AAG AAG AUU UUU AUU AUG AAG UGU UCC CAG UGC CAC ACC

V E K G G K H K T G P N L H G L F G R K

GUU GAA AAG GGA GGC AAG CAC AAG ACU GGG CCA AAU CUC CAU GGU CUC UUU GGG CGG AAG

T G Q A P G Y S Y T A A N K N K G I I W

ACA GGU CAG GCC CCU GGA UAC UCU UAC ACA GCC GCC AAU AAG AAC AAA GGC AUC AUC UGG

G E D T L M E Y L E N P K K Y I P G U K

GGA GAG GAU ACA CUG AUG GAG UAU UUG GAG AAU CCC AAG AAG UAC AUC CCU GGA ACA AAA

M I F V G I K K K E E R A D L I A Y L K

AUG AUC UUU GUC GGC AUU AAG AAG AAG GAA GAA AGG GCA GAC UUA AUA GCU UAU CUC AAA

K A T N E -

AAA GCU ACU AAU GAG UAA

May 17th Workshop

introns exons untranslated regions
Introns, Exons, & Untranslated Regions

>Cytochrome c somatic range=chr7:25129845-25131480

AGGGCGCGGGAGCGCGGAGCGAGTTTGGTTGCACTTACACCGGTACTTAA

GCGCGGACCGGCGTGTCCTTGGACTTAGAGAGTGGGGACGTCCGGCTTCG

GAGCGGGAGTGTTCGTTGTGCCAGCGACTAAAAAGAGgtgagagcgggtc

gcggaggccgcacctggttagaggcagagctgtgggaggcgcgcacttgc

gagcgaccgaaacccaagcggggagcattcgagtggagcccgcgctgggt

gggagggcggggagtgaagaccctggactgtggtcagaccgagctgggcg

agtaacggcttgaggtgcggcggagccctaactagggacaggtatggtct

cggtcagggactggaggcggcttggatacagatccgaggaggaggcggcc

tcttccgtagtggttgctgaagggctatggaaatgataggcaagacttcc

ctcctggaaagccgaagcttagagcttcacgttcttcttcagagggcaaa

agctgttgctcttctaataaggggccagttcttttcgtgggcacatgttt

cttccgtcagtcgttctgacatcctagaaggagtttcatcaatcaccttg

aaaccgacctggacgggtgacctcgtggtcgccccaggagatcacaggta

ggggagttgggatgtccccgggggaccgtgcagcctgcccctgagctccc

attcacaagttcgagtgtcaagctactcctgtgacctgggcagatagaaa

cagccaggaccgctttttaaacatttgtgtgctttgcgttatcctcaggg

agaggtggctttacattgtagtaagattaaatggttaggtctttttaaaa

gttgcggttgtggtgattttggcttaatgtgttcgcccttgagcttcaga

tctgtgacttcgtgaccatgattgtctcttctgaaactggagtttgaatt

aggttccctctttgcttgggctttaacgttccttcacgtatacacacaaa

aatacgtttttgaggaggtactcctaaaaatgtttttggtattaaagaat

atttggtataaagagtattaaagcaaaacaagattcattctggtatttaa

tgacataaattagcaatggattggtaattaagtggctagagtggtcattc

atttacactgtatttgttacctgaggaaaaatttactaagttgaagcttt

cgtttttagAATTAAATATGGGTGATGTTGAGAAAGGCAAGAAGATTTTT

ATTATGAAGTGTTCCCAGTGCCACACCGTTGAAAAGGGAGGCAAGCACAA

GACTGGGCCAAATCTCCATGGTCTCTTTGGGCGGAAGACAGGTCAGGCCC

CTGGATACTCTTACACAGCCGCCAATAAGAACAAAGgtaagagtcacttg

ttaaataaaacaacacaaaatgcaggaatataacatgtggcaaactatca

ggagtgtgaaataaccgatgcattctttcttgtttagGCATCATCTGGGG

AGAGGATACACTGATGGAGTATTTGGAGAATCCCAAGAAGTACATCCCTG

GAACAAAAATGATCTTTGTCGGCATTAAGAAGAAGGAAGAAAGGGCAGAC

TTAATAGCTTATCTCAAAAAAGCTACTAATGAGTAA

Actual gene sequence of Human Cytochrome c including introns and 5’ untranslated region taken directly from chromosome 7 genomic sequence.

The blue portion of sequence becomes the mature mRNA

(some 3’ untranslated sequence left off for clarity).

May 17th Workshop

reading frames
Reading Frames

cgtttttag

AATTAAATATGGGTGATGTTGAGAAAGGCAAGAAGATTTTT

ATTATGAAGTGTTCCCAGTGCCACACCGTTGAAAAGGGAGGCAAGCACAA

GACTGGGCCAAATCTCCATGGTCTCTTTGGGCGGAAGACAGGTCAGGCCC

CTGGATACTCTTACACAGCCGCCAATAAGAACAAAG

gtaagagtcacttg

May 17th Workshop

reading frames1
Reading Frames

cgtttttagAATTAAATATGGGTGATGTTGAGAAAGGCAAGAAGATTTTT

ATTATGAAGTGTTCCCAGTGCCACACCGTTGAAAAGGGAGGCAAGCACAA

GACTGGGCCAAATCTCCATGGTCTCTTTGGGCGGAAGACAGGTCAGGCCC

CTGGATACTCTTACACAGCCGCCAATAAGAACAAAGgtaagagtcacttg

ttaaataaaacaacacaaaatgcaggaatataacatgtggcaaactatca

ggagtgtgaaataaccgatgcattctttcttgtttagGCATCATCTGGGG

AGAGGATACACTGATGGAGTATTTGGAGAATCCCAAGAAGTACATCCCTG

GAACAAAAATGATCTTTGTCGGCATTAAGAAGAAGGAAGAAAGGGCAGAC

TTAATAGCTTATCTCAAAAAAGCTACTAATGAGTAA

If we translate the whole segment we get no open reading frames….

May 17th Workshop

open reading frames are rare so they probably indicate a gene
Open Reading Frames are Rare… (so they probably indicate a gene).

AATTAAATATGGGTGATGTTGAGAAAGGCAAGAAGATTTTT

ATTATGAAGTGTTCCCAGTGCCACACCGTTGAAAAGGGAGGCAAGCACAA

GACTGGGCCAAATCTCCATGGTCTCTTTGGGCGGAAGACAGGTCAGGCCC

CTGGATACTCTTACACAGCCGCCAATAAGAACAAAG

GCATCATCTGGGG

AGAGGATACACTGATGGAGTATTTGGAGAATCCCAAGAAGTACATCCCTG

GAACAAAAATGATCTTTGTCGGCATTAAGAAGAAGGAAGAAAGGGCAGAC

TTAATAGCTTATCTCAAAAAAGCTACTAATGAGTAA

May 17th Workshop

ad