MM
Download
1 / 5

Supplementary Figure S1 - PowerPoint PPT Presentation


  • 56 Views
  • Uploaded on

MM. pSPL3. MM. pSPL3. 800 bp. 500 bp. 700 bp. 450 bp. 600 bp. 400 bp. 500 bp. 350 bp. 400 bp. 300 bp. 300 bp. 250 bp. HeLa. COS-7. Supplementary Figure S1. Coelho et al (2014). exon 9. exon 9. gt cagtctc cca g gt aggatcctggggc. exon 8. 3’- gt c ca tcctaggacc - 5’. LNA1.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Supplementary Figure S1' - ryann


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

MM

pSPL3

MM

pSPL3

800 bp

500 bp

700 bp

450 bp

600 bp

400 bp

500 bp

350 bp

400 bp

300 bp

300 bp

250 bp

HeLa

COS-7

Supplementary Figure S1

Coelho et al (2014)


exon 9

exon 9

gtcagtctcccaggtaggatcctggggc

exon 8

3’- gtccatcctaggacc - 5’

LNA1

10 nt

gtcagtctcccaggtaggatcctggggc

exon 8

3’- agagggtccatcctag - 5’

LNA2

5 nt

Supplementary Figure S2

Coelho et al (2014)


-LNA

+LNA1(0.5 μM)

MM

400 bp

300 bp

Supplementary Figure S3

Coelho et al (2014)


A

p.D274Gfs*17

WT

~45 kDa

~35 kDa

B

C

Supplementary Figure S4

Coelho et al (2014)


A

Denatured protein (normalized)

[θ]

(mdeg.cm-2.dmol-1)

a

b

a

b

B

T (°C)

λ (nm)

T (°C)

C

b

b

a

Aggregated protein

(normalized)

Aggregated protein (normalized)

a

D

T (°C)

Time (min)

Supplementary Figure S5

Coelho et al (2014)


ad