OVM246
This presentation is the property of its rightful owner.
Sponsored Links
1 / 6

Exon 2 PowerPoint PPT Presentation


  • 67 Views
  • Uploaded on
  • Presentation posted in: General

oVM246. 3’ss. oVM245. Exon 3. oVM244. K8 β intron. …acacaagacagcugcagcag GUAUAGACGGGAAACAGGUGUCUAUCUUGGCCGGCUGGUUACUCAAAUGGGAACAAUGGCGCCACCUUGCUGUCUUUGUAG gcauuagaagaaaaggaugc…. oVM243. Exon 2. oVM242. STOP. 5’ss. oVM241. Figure S1. K8 β. 1. 2. 3. 4. RBM15. -. -. +. +. -.

Download Presentation

Exon 2

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Exon 2

oVM246

3’ss

oVM245

Exon 3

oVM244

K8β intron

…acacaagacagcugcagcagGUAUAGACGGGAAACAGGUGUCUAUCUUGGCCGGCUGGUUACUCAAAUGGGAACAAUGGCGCCACCUUGCUGUCUUUGUAGgcauuagaagaaaaggaugc…

oVM243

Exon 2

oVM242

STOP

5’ss

oVM241

Figure S1


Exon 2

K8β

1

2

3

4

RBM15

-

-

+

+

-

ORF57

-

+

+

K8

+

+

+

+

C

N

C

N

RNA

C

N

C

N

-

K8

-

GAPDH

U6

Figure S2


Exon 2

A

BCBL-1

0

6

12

24

32

56

VA (h)

SRSF3

RBM15

- full

ORF57

- cleaved

β-tubulin

SRSF3/RBM15 (%)

1

4

47

878

2220

2478

B

HEK293

1000

ORF57 DNA (ng)

100

500

0

SRSF3

RBM15

- full

- cleaved

ORF57

β-tubulin

Figure S3


Exon 2

Supplementary Table S1: Peptides and corresponding proteins associated with KSHV ORF57 in THE absence (Fig 2A, sample 1) or presence (Fig 2A, sample 2) of ectopically expressed RBM15. The peptides and proteins were identified with LC-MS/MS.


Exon 2

SUPPLEMENTARY TABLE S2. Biotinylated RNA oligos from the KSHV K8β intron region and

the HPV16 ESE used in RNA pulldowns. Underlined are point mutations.


Exon 2

Supplementary Table S3: Primers used for RT-PCR and Northern Blotting.

T7, T7 promoter; U1bs, U1 binding site


  • Login