Exon 2 - PowerPoint PPT Presentation

1 / 6

  • Uploaded on
  • Presentation posted in: General

oVM246. 3’ss. oVM245. Exon 3. oVM244. K8 β intron. …acacaagacagcugcagcag GUAUAGACGGGAAACAGGUGUCUAUCUUGGCCGGCUGGUUACUCAAAUGGGAACAAUGGCGCCACCUUGCUGUCUUUGUAG gcauuagaagaaaaggaugc…. oVM243. Exon 2. oVM242. STOP. 5’ss. oVM241. Figure S1. K8 β. 1. 2. 3. 4. RBM15. -. -. +. +. -.

I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.

Download Presentation

Exon 2

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.

- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript

Exon 2




Exon 3


K8β intron



Exon 2





Figure S1

Exon 2



































Figure S2

Exon 2









VA (h)



- full


- cleaved


SRSF3/RBM15 (%)










ORF57 DNA (ng)






- full

- cleaved



Figure S3

Exon 2

Supplementary Table S1: Peptides and corresponding proteins associated with KSHV ORF57 in THE absence (Fig 2A, sample 1) or presence (Fig 2A, sample 2) of ectopically expressed RBM15. The peptides and proteins were identified with LC-MS/MS.

Exon 2

SUPPLEMENTARY TABLE S2. Biotinylated RNA oligos from the KSHV K8β intron region and

the HPV16 ESE used in RNA pulldowns. Underlined are point mutations.

Exon 2

Supplementary Table S3: Primers used for RT-PCR and Northern Blotting.

T7, T7 promoter; U1bs, U1 binding site

  • Login