Biology Journal 9/16/2014
Download
1 / 70

True or false: Amino acids are bonded together in long chains by what are known as peptide bonds. - PowerPoint PPT Presentation


  • 98 Views
  • Uploaded on
  • Presentation posted in: General

Biology Journal 9/16/2014. 2.4 Homework Quiz!. True or false: Amino acids are bonded together in long chains by what are known as peptide bonds. True or false: The sequence of amino acids for a protein is found on code of the DNA.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha

Download Presentation

True or false: Amino acids are bonded together in long chains by what are known as peptide bonds.

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


True or false amino acids are bonded together in long chains by what are known as peptide bonds

Biology Journal 9/16/2014

2.4 Homework Quiz!

  • True or false: Amino acids are bonded together in long chains by what are known as peptide bonds.

  • True or false: The sequence of amino acids for a protein is found on code of the DNA.

  • How many different kinds of amino acids are used by ribosomes to make proteins?

  • What is a proteome?


True or false amino acids are bonded together in long chains by what are known as peptide bonds

Topic 2: Molecular biology (21 hours)


True or false amino acids are bonded together in long chains by what are known as peptide bonds

Review!

a. What kind of molecule is this?

b. What are its parts called?

It’s an amino acid!

(this one is called asparagine)

R group

(in this case CH2CONH2)

Amine

(NH2)

Carboxyl

(COOH)

Alpha carbon

(the middle C where the R group is attached)


True or false amino acids are bonded together in long chains by what are known as peptide bonds

Protein and Amino Acids

  • Proteins do everything!

  • Protein makes skin stretchy, bones tough, gives your body parts their color, lets you digest different foods, makes up hormones, creates your immune system …


True or false amino acids are bonded together in long chains by what are known as peptide bonds


True or false amino acids are bonded together in long chains by what are known as peptide bonds

Generalized Amino Acid that fold up into

How many amino acids make up this polypeptide?



What do ribosomes do

Ribosomes that fold up into : part of the cell that makes proteins from an RNA copy of the DNA code. They join amino acids together with peptide bonds.

What do ribosomes do?


True or false amino acids are bonded together in long chains by what are known as peptide bonds

There are that fold up into infinite possibilities of proteins! They can be any length, and any combination of amino acids.

Turns garbage into bacon

Your welcome.


True or false amino acids are bonded together in long chains by what are known as peptide bonds


True or false amino acids are bonded together in long chains by what are known as peptide bonds

Denaturing


True or false amino acids are bonded together in long chains by what are known as peptide bonds

A fever can kill you! Why? a process called


Proteome the set of all of the proteins an organism makes
Proteome a process called : The set of all of the proteins an organism makes.

DNA in 23 chromosomes

Transcribed into mRNA

Genome

Translated into an amino acid sequence by ribosomes

Proteome

Folds into proteins

Polypeptide

Every individual has its own unique genome which leads to its own unique proteome


True or false amino acids are bonded together in long chains by what are known as peptide bonds

Proteins do everything! Such as… a process called

Motor Proteins: They move, allowing cells to change shape. Muscle cells are packed with these.


True or false amino acids are bonded together in long chains by what are known as peptide bonds

Proteins do everything! Such as… a process called

Transport Proteins: These are proteins stuck in the cell membrane that let specific substances in or out of your cells.


True or false amino acids are bonded together in long chains by what are known as peptide bonds

Proteins do everything! Such as… a process called

Receptor Proteins: These are proteins stuck in the cell membrane that are used for cells to communicate with eachother.


True or false amino acids are bonded together in long chains by what are known as peptide bonds

Proteins do everything! Such as… a process called

  • Your immune system tells the difference between “self” and “non-self” by these receptors.


True or false amino acids are bonded together in long chains by what are known as peptide bonds

  • The blood types are: A, B, AB and O

  • Doctors killed a lot of dogs before they figured this one out…




True or false amino acids are bonded together in long chains by what are known as peptide bonds

There are many ways of representing proteins meat is animal muscle.

DNA Helicase

Simplified model


True or false amino acids are bonded together in long chains by what are known as peptide bonds

There are many ways of representing proteins meat is animal muscle.

DNA Helicase

Space-filling model


True or false amino acids are bonded together in long chains by what are known as peptide bonds

There are many ways of representing proteins meat is animal muscle.

DNA Helicase

Model showing -helixes and -sheets.


20 amino acids bonded together in different orders can form all proteins
20 amino acids bonded together in different orders can meat is animal muscle.form all proteins.

What do proteins do?

Everything!

The function of the protein is defined by its shape.


20 amino acids bonded together in different orders can form all proteins1
20 amino acids bonded together in different orders can form all proteins.

Fibrous

Long, insoluble proteins

Parallel polypeptide chains

Cross-linked

Spider Silk


20 amino acids bonded together in different orders can form all proteins2
20 amino acids bonded together in different orders can form all proteins.

Globular

Folded, compact polypeptide chains

Almost spherical shapes

Rubisco

Rhodopsin

Insulin

Immunoglobulin


Denaturation
Denaturation all proteins.

A process that destroys the complex structure of a protein.

  • Heat

  • Strong acids

  • Strong alkalis

    New structure = new function

    Denaturation of an egg protein


Proteomics
Proteomics all proteins.

DNA in 23 chromosomes

Transcribed into mRNA

Genome

Translated into an amino acid sequence by ribosomes

Proteome

Folds into proteins

Polypeptide

Every individual has its own unique genome which leads to its own unique proteome


True or false amino acids are bonded together in long chains by what are known as peptide bonds

A chemical reaction is shown below. all proteins.

Name each reactant and product.

What kind of reaction is this?

Where should water be present in the reaction? How many molecules of water?

Review!

Catabolic Hydrolysis Reaction

Monopeptide

(amino acid)

Monopeptide

(amino acid)

Dipeptide

+

H2O

  • Hydrolysis (water is split)

  • It “fills in” each monomer


True or false amino acids are bonded together in long chains by what are known as peptide bonds

A chemical reaction is shown below. all proteins.

Name each reactant and product.

What kind of reaction is this?

Where should water be present in the reaction? How many molecules of water?


True or false amino acids are bonded together in long chains by what are known as peptide bonds

A chemical reaction is shown below. all proteins.

Name each reactant and product.

What kind of reaction is this?

Where should water be present in the reaction? How many molecules of water?

Catabolic Hydrolysis Reaction

Monopeptide

(amino acid)

Monopeptide

(amino acid)

Dipeptide

+

H2O

  • Hydrolysis (water is split)

  • It “fills in” each monomer



Dna has the recipe to make proteins
DNA has the “recipe” to make proteins. all proteins.

A gene is a segment of DNA that has the instructions to make a particular protein.

“Hmmm… how many teaspoons of cytosine was I supposed to add?”


True or false amino acids are bonded together in long chains by what are known as peptide bonds

The base pairs on DNA determine the amino acids, and thus the specific shape, that the protein will have.


True or false amino acids are bonded together in long chains by what are known as peptide bonds

For example… we all have genes for hair color. The base pairs on this DNA determines what proteins are in our hair, and thus, what our hair looks like.

Of course, you can always change it later…


What does it mean to be a translator

What does it mean to be a translator? pairs on this DNA determines what proteins are in our hair, and thus, what our hair looks like.

What does it mean to transcribe something?


What s the difference between dna and rna
What’s the difference between pairs on this DNA determines what proteins are in our hair, and thus, what our hair looks like.DNA and RNA?


True or false amino acids are bonded together in long chains by what are known as peptide bonds

DNA and RNA comparison pairs on this DNA determines what proteins are in our hair, and thus, what our hair looks like.



Transcription and translation is done every time a cell makes a protein
Transcription and translation is done every time a cell makes a protein.

So, almost every cell in your body is doing this all the time!

Above: the structural protein collagen. This poor guy will be making lots of it soon to repair his body.


Ancient egypt was well known for its scribes that made copies of documents
Ancient Egypt was well known for its scribes that made copies of documents.

Nowadays we don’t really need them, we have copy machines…


True or false amino acids are bonded together in long chains by what are known as peptide bonds
Transcription copies of documents. is making a copy of the DNA onto mRNA (messenger RNA). The enzyme that makes it is called RNA polymerase.

Some people transcribe their homework all the time.


Mrna is a temporary disposable copy of dna it s sent from the nucleus to the ribosome
mRNA is a temporary, disposable copy of DNA. It’s sent from the nucleus to the ribosome.

DNA is permanent. You don’t want to change or mess with it.

RNA is a disposable copy.


If this was a chain of dna what would the mrna strand be
If this was a chain of DNA, what would the mRNA strand be? from the nucleus to the ribosome.

C T G A C T T A G A T A

G A C U G A A U C U A U


True or false amino acids are bonded together in long chains by what are known as peptide bonds

What does DNA have the “recipe” to make? from the nucleus to the ribosome.

DNA is the recipe to make protein!


What do ribosomes do1
What do from the nucleus to the ribosome.ribosomes do?

Ribosomes make proteins!


What are proteins made out of why do they have the shape that they have
What are proteins made out of? Why do they have the shape that they have?

Proteins are made out of amino acids. The different chemical properties of the amino acids cause the chain to fold up in specific ways.


Translation mrna goes to the ribosome and it is translated into an amino acid sequence
Translation that they have?: mRNA goes to the ribosome, and it is translated into an amino acid sequence.

tRNA (transfer RNA) brings the correct amino acid for every 3 base pairs.


True or false amino acids are bonded together in long chains by what are known as peptide bonds

Large Subunit

Small Subunit


The 3 bases on mrna is called a codon
The 3 bases on mRNA is called a that they have?codon.

The 3 bases on tRNA is called an anti-codon.




What amino acids does this mrna code for aug uua gac cuc uga
What amino acids does this mRNA code for? human body?AUG UUA GAC CUC UGA


True or false amino acids are bonded together in long chains by what are known as peptide bonds

A translator puts information from one language into another.

Translation puts the genetic code (AGTC’s) into the code of amino acids.


What amino acids does this mrna code for gua aaa cuu cua uag
What amino acids does this mRNA code for? another.GUA AAA CUU CUA UAG


True or false amino acids are bonded together in long chains by what are known as peptide bonds

The translator another.

(ribosome and tRNA)

The scribe

(RNA polymerase)

Protein

DNA

mRNA

What do we call this step?

What do we call this step?

Transcription

Translation


Convert the dna to mrna then convert the mrna to amino acids
Convert the DNA to mRNA another.Then, Convert the mRNA to amino acids.

TAT TCA CTA CTG

GCC

CGG

AUA AGU GAU GAC

Isoleucine Serine Aspartic Acid Aspartic Acid

Argenine

What do we call this step?

Transcription

What do we call this step?

Translation




True or false amino acids are bonded together in long chains by what are known as peptide bonds

This is called the central dogma of biology. another.(That just means that it is a really important idea)


True or false amino acids are bonded together in long chains by what are known as peptide bonds

Actual gene being transcribed

TATA box

DNA strand:

TCCACGACTATACCGACTACTCTACGGGAATATG

GGCUGAUGAGAUGCCCUUAUAC

mRNA strand:

  • mRNA gets a 5’GTP and a poly-A tail to mark the beginning and end. This helps identify it and “protect” it.

Poly-A tail

5’ GTP

PPPG

AAAAAAAAA


True or false amino acids are bonded together in long chains by what are known as peptide bonds

Biology Journal 10/18/2013 polymerase where to start copying.

Transcription

Translation

Ribosome

tRNA

RNA polymerase

Replication

mRNA

Protein

DNA helicase

DNA polymerase

DNA

Happens in the nucleus

Happens in the cytoplasm / at the ribosomes

Label each molecule (the pictures).

Label the process that makes each molecule (the purple arrows).

List the name of the enzymes / molecules that carry out each process.

Identify the location where each of these molecules / processes are.


True or false amino acids are bonded together in long chains by what are known as peptide bonds

This is called the central dogma of biology. polymerase where to start copying.(That just means that it is a really important idea)


ad
  • Login