IMPORTANCIA DEL DESARROLLO TECNOLÓGICO EN MÉXICO
Sponsored Links
This presentation is the property of its rightful owner.
1 / 51

México, D. F. Febrero 27, 2008 PowerPoint PPT Presentation


  • 79 Views
  • Uploaded on
  • Presentation posted in: General

IMPORTANCIA DEL DESARROLLO TECNOLÓGICO EN MÉXICO. María Alejandra Mora Avilés, Ph.D. México, D. F. Febrero 27, 2008. Temática. Cuál es la importancia de la biotecnología para la actividad agrícola como un medio para generar mayores producciones y rentabilidad?

Download Presentation

México, D. F. Febrero 27, 2008

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


IMPORTANCIA DEL DESARROLLO TECNOLÓGICO EN MÉXICO

María Alejandra Mora Avilés, Ph.D.

México, D. F.

Febrero 27, 2008


Temática

  • Cuál es la importancia de la biotecnología para la actividad agrícola como un medio para generar mayores producciones y rentabilidad?

  • Cuáles son sus posibles efectos sobre los recursos naturales actuales?

  • Cuáles son los riesgos para las cadenas alimenticias, ecosistemas u otros asociados?

  • Es importante la utilización de estos materiales?

  • Qué desarrollos biotecnológicos están en marcha en INIFAP?

  • Qué productos o resultados están disponibles para los productores?

  • A qué se debe el gran debate sobre el uso de OGM´S?

  • Cuál es la postura que debe asumir México?

  • Contamos con legislaciones y marcos regulatorios adecuados?

  • Qué nos hace falta sobre el tema?


Temática

  • Cuál es la importancia de la biotecnología para la actividad agrícola como un medio para generar mayores producciones y rentabilidad?

  • Cuáles son sus posibles efectos sobre los recursos naturales actuales?

  • Cuáles son los riesgos para las cadenas alimenticias, ecosistemas u otros asociados?

  • Es importante la utilización de estos materiales?

  • Qué desarrollos biotecnológicos están en marcha en INIFAP?

  • Qué productos o resultados están disponibles para los productores?

  • A qué se debe el gran debate sobre el uso de OGM´S?

  • Cuál es la postura que debe asumir México?

  • Contamos con legislaciones y marcos regulatorios adecuados?

  • Qué nos hace falta sobre el tema?


  • Tiene tanta importancia como nos resuelva un problema

  • Tiene tantos efectos o riesgos como tantos no evaluemos


  • No ha ocurrido ningún evento que lamentar asociado a un producto biotecnológico (ambiente, cadena productiva, salud).

  • El cambio climático, contaminación, disponibilidad de agua, …

  • Emplear productos biotecnológicos para adaptarse al cambio.


  • Genómica y proteómica, términos usados para la identificación y caracterización de grupos de genes, RNA y proteínas.

    Proyecto del Genoma Humano

    Enfermedades Cura


Tecnología Convencional

Nueva Tecnología

Riesgo/Beneficio

Riesgo/Beneficio


Temática

  • Cuál es la importancia de la biotecnología para la actividad agrícola como un medio para generar mayores producciones y rentabilidad?

  • Cuáles son sus posibles efectos sobre los recursos naturales actuales?

  • Cuáles son los riesgos para las cadenas alimenticias, ecosistemas u otros asociados?

  • Es importante la utilización de estos materiales?

  • Qué desarrollos biotecnológicos están en marcha en INIFAP?

  • Qué productos o resultados están disponibles para los productores?

  • A qué se debe el gran debate sobre el uso de OGM´S?

  • Cuál es la postura que debe asumir México?

  • Contamos con legislaciones y marcos regulatorios adecuados?

  • Qué nos hace falta sobre el tema?


ALIMENTOS


Nutracéuticos

  • Origen vegetal

  • Substancias asociadas a la prevención y tratamiento de enfermedades crónico degenerativas (cáncer, diabetes, coronarias, otros)

  • Componentes llamados fitoquímicos (antioxidantes, taninos, fibra, etc.,)

  • Frijol, maíz, chile, jitomate, chaya, garambullo, xoconoxtle, jamaica, etc. han atraído la atención.


Fitoquímicos

  • la fibra, licopeno y el ácido gálico pueden prevenir el cáncer del seno, próstata y colon y problemas cardiovasculares


Líneas de investigación

Caracterización de Compuestos Nutracéuticos

  • identificar materiales nutracéuticos de frijol, chile, chaya, garambullo, xoconoxtle, flor de granada, etc.

  • determinar la presencia de nuevos compuestos anticancerígenos

  • establecer la capacidad anti-cancerígena y de recuperación en diabetes

    Interés de la Unión Europea


CULTIVO DE TEJIDOS VEGETALES


Objetivos

como parte intermedia en procesos de mejoramiento de cultivos


Objetivos

los problemas que el laboratorio aborda a través del área de Transferencia de Genes son:

resistencia a plagas

resistencia a enfermedades

resistencia a sequía

calidad nutrimental


Frijol regenerado a través de organogénesis con alta eficiencia

Interés de E.U.A (U. Michigan, Arizona SU), Canadá (PULSE), CIAT


líneas de investigación

evaluación de genes con potencial para incrementar la tolerancia a la sequía

Bouteloua gracilis

Navajita azul


líneas de investigación

diseño y establecimiento de sistemas de cultivo de tejidos y transformación genética para gramíneas y leguminosas


líneas de investigación

la detección cuantitativa de transgenes por métodos moleculares

(PCR y PCR en tiempo real)

bioensayos y análisis inmunológicos para definir la inmigración de transgenes


FITOPATOLOGÍA MOLECULAR


Estrategia

INTERACCIÓN PLANTA-MICROORGANISMO

  • Resistencia Simbiosis

  • Diversidad genética

  • Estructura de poblaciones

  • Mecanismos de variabilidad

Genotipos

Cepas y Patotipos

SELECCIÓN DE GENOTIPOS DEL HOSPEDERO Y

DE CEPAS DE MICROORGANISMOS

  • Mapeo de marcadores y genes de resistencia y de asociaciones benéficas

  • Mapeo y marcadores de genes involucrados en:

  • Patogenicidad

  • Variabilidad, y en el reconocimiento y establecimiento de asociaciones benéficas

Identificación de Variantes

Selección Asistida

AISLAMIENTO, CARACTERIZACIÓN Y EXPRESIÓN DE GENES


la producción de chile es afectada por Virus y Hongos

se han identificado importantes fuentes de resistencia contra virus (PHYVV, PepGMV y su mezcla)

la caracterización molecular de los genotipos resistentes

identificación de secuencias de ADNasociadas a la resistencia


la búsqueda de genotipos de chile con resistencia al complejo de hongos causantes de pudriciones de raíz y del fruto, ha permitido identificar tres líneas con altos niveles de resistencia


el hongo Colletotrichum lindemuthianum es un importante patógeno del frijol al nivel mundial

las bases genéticas de la virulencia del hongo han sido poco estudiadas

actualmente contamos con cepas del hongo que permitirán dirigir la búsqueda de genes involucrados en el desarrollo de la enfermedad


MARCADORES MOLECULARES


1

2

3

1

2

3

ADN

1

2

3

digestión

PCR

1 2 3

hibridación

RFLP

RAPD

SSR

AFLP

1 2 3


Rhizoctonia solani

Fusarium sp

Diversidad Genética

conocer la diversidad genética delos patógenospermite realizarbúsquedas de fuentes de resistencia amplia y durable


0.4

0.5

0.6

0.7

Similaridad

0.8

0.9

1.0

PUEBLA

MÉXICO

JALISCO

CHIAPAS

HIDALGO

DURANGO

TLAXCALA

ZACATECAS

CHIHUAHUA

MICHOACAN

Diversidad Genética Nacional de Fitopatógenos

Colletotrichum lindemuthianum

Colletotrichum gloeosporioides

Fusarium sp.

Rhizoctonia solani

Phytophthora capsici


QRO1

QRO2

AGS18

AGS13

AGS10

QRO3

AGS7

YUC3

YUC4

AGS5

AGS11

A

AGS12

PUE1

D1*

D2*

AGS16

AGS17

Querétaro

Aguascalientes

AGS6

Yucatán

AGS4

Coahuila

AGS9

AGS15

Jalisco

COL1

Colima

JAL1

* Origen desconocido

COAH1

QRO5

AGS2

AGS1

B

AGS8

AGS14

QRO4

AGS3

YUC1

YUC2

0.82

0.86

0.91

0.95

1.00

Coeficiente de Similaridad


aplicaciones

Secuenciación

ATGACGATGACGATGACGATAGACAGTAGACGTAGACGATGACAGTAGACGATAGCAGATGACAGATGAACGATGAACGATAGACGATAGACGATGACAGTAGACAGTAGACAGGTAGATAGCAGATAGATAGAG


aplicaciones

“Finger-Printing”

Huella Genética


Blanco Sin

Blanco Sin

Evora-98

Evora-98

Progreso

Progreso

Jamu-96

Jamu-96

aplicaciones

se están generado las “Huellas Genéticas” de diversas variedades en diferentes especies

huellas genéticas de cuatro variedades de garbanzo generadas por el INIFAP


SELECCIÓN

ASISTIDA


aplicaciones

Selección Asistida

permite al fitomejorador identificar a los individuos segregantes que presentan un gen de interés en función del ligamiento entre el gen y los marcadores que lo flanquean


aplicaciones

Selección Asistida

es factible reducir los tiempos necesarios para fijar una determinada característica en una población

transferir los genes de interés a líneas élite


aplicaciones

Método

Tradicional

RC1

RC2

RC3

RC6

75.0

87.7

93.3

99.0

85.5

99.0

Marcadores

Moleculares

Tiempo


aplicaciones

E S

Susceptible Resistente

P1 P2


aplicaciones

E S S S S S

Susceptible Resistente

P1 P2 F2


Perspectivas

  • Las secuencias de Arabidopsis y arroz obtenidas en el 2002 y posteriormente más de 40 especies de plantas sirven de base para entender el funcionamiento de los genes.

    • Nutrición,

    • Eficiencia en manejo de agua,

    • Adaptación a suelos con baja fertilidad,

    • Resistencia a plagas y enfermedades,… Genómica Funcional


  • Los mejoradores están solicitando caracterización molecular de los eventos relevantes (actuales y potenciales) en sus materiales para el seguimiento y protección de éstos.


Megaproyecto Maíz

  • Caracterización de nuevos genes y marcadores moleculares asociados a ventajas comparativas en genotipos de importancia,

  • Validarsu presencia y función en genotipos con potencial,

  • Integrar esta información en programas de mejoramiento.


Temática

  • Cuál es la importancia de la biotecnología para la actividad agrícola como un medio para generar mayores producciones y rentabilidad?

  • Cuáles son sus posibles efectos sobre los recursos naturales actuales?

  • Cuáles son los riesgos para las cadenas alimenticias, ecosistemas u otros asociados?

  • Es importante la utilización de estos materiales?

  • Qué desarrollos biotecnológicos están en marcha en INIFAP?

  • Qué productos o resultados están disponibles para los productores?

  • A qué se debe el gran debate sobre el uso de OGM´S?

  • Cuál es la postura que debe asumir México?

  • Contamos con legislaciones y marcos regulatorios adecuados?

  • Qué nos hace falta sobre el tema?


Desarrollan arroz que vacuna contra el cólera en JapónLos granos de arroz modificados incluyen entre 15 y 30 microgramos de proteínas de la bacteria del cólera, y se deben consumir en pequeñas dosis, como un medicamento, no como un alimento.

Esta investigación pretende colocar a Japón a la cabeza del ranking mundial de la manipulación genética de plantas con fines médicos.

EFE El UniversalViernes 22 de febrero de 2008.


Organismos Genéticamente Modificados

  • Declaración de Río “La biotecnología tiene el potencial de proporcionar una vida más segura, pero debe ser usada de una manera segura”.

  • Muchos cambios ocurren no debido a la tecnología sino al impacto y a la implementación de la misma.

  • No es un tema de conocimiento científico sino de respeto social.


  • México toma sus decisiones basado en la determinación de riesgo y el principio precautorio (Protocolo de Cartagena).

    Caso x Caso (evaluación por evento y por especie)

    Paso x Paso (disminuir progresivamente el nivel de confinamiento)


Riesgo = Daño x Exposición

  • Hay riesgo cero?

  • Qué hacer cuando Riesgo >0

    Análisis de riesgo/beneficio?

    Modificar el OGM para reducir el daño y/o exposición?

    Abandonar el proyecto?


Principales preocupaciones

  • Flujo génico (Diversidad genética, flora asociada, polinizadores, híbridos, plantas voluntarias)

  • Inocuidad (Alergias, toxicidad)

  • Mercado (Costo)

  • Regulación (Normatividad)


Qué postura debe asumir México?

  • La que le venga bien de acuerdo a su entorno social, económico, medioambiental.

  • Regulación que ha ido creciendo en experiencia.

  • Evitar paralizarnos ante lo desconocido y fomentar investigación en temas concretos.


GRACIAS

[email protected]

www.inifap.gob.mx


  • Login