Next generation sequencing in science and medicine
Download
1 / 27

Next Generation Sequencing in Science and Medicine - PowerPoint PPT Presentation


  • 168 Views
  • Updated On :

Next Generation Sequencing in Science and Medicine. The Presidential Commission for the Study of Bioethical Issues 28 February 2011 Washington D.C. Jim Evans MD, Ph.D University of North Carolina at Chapel Hill. DNA Has Only Two Jobs. It serves as a store of information

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Next Generation Sequencing in Science and Medicine' - reia


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
Next generation sequencing in science and medicine l.jpg

Next Generation Sequencing in Science and Medicine

The Presidential Commissionfor the Study of Bioethical Issues

28 February 2011

Washington D.C.

Jim Evans MD, Ph.D

University of North Carolina at Chapel Hill


Dna has only two jobs l.jpg
DNA Has Only Two Jobs

  • It serves as a store of information

    • Ensuring that information is passed on to each new cell upon division (and the next generation)

  • It directs the synthesis of proteins

    • Which are necessary to carry out the functions of a living organism


Dna s structure explains how it accomplishes both jobs l.jpg
DNA’s Structure Explains How it Accomplishes Both Jobs

DNA Serves as a Store of Information

A

C

T

G

T

A

G

C

Adenine (A)

Cytosine (C)

Always binds to

Always binds to

Thymine (T)

Guanine (G)

As a double helix, each DNA molecule contains a copy of itself


Dna s structure explains how it accomplishes both jobs4 l.jpg
DNA’s Structure Explains How it Accomplishes Both Jobs

DNA Directs the Synthesis of Proteins

  • It is the order of the bases that provides the instructions for protein synthesis

  • One stretch of DNA directs the synthesis of one type of protein, another stretch directs the synthesis of another type of protein

A

C

T

G


Slide5 l.jpg

We call a stretch of DNA that directs the synthesis of one particular protein a Gene

Gene #1

Gene #2

Gene #3


Dna sequencing l.jpg
DNA Sequencing particular protein a

  • You have 3 billion bases arrayed in a unique order, with ~20,000 genes that direct the synthesis of all the proteins that comprise you

  • “Sequencing” DNA is simply the elucidation of the order of the bases in an organism’s DNA strand

  • The unique order of your bases greatly influences your health, e.g.

    • What disease you are more - or less - prone to

    • How you will react to different medications

  • A human “genome” is about 6 feet of DNA

    • And each of your cells contains two copies of your genome


A human dna sequence l.jpg
A Human DNA Sequence particular protein a

atcgtgactgattaccaggatcctagcggatcctactgacctgacgtacgtaatgcagtggtcaggttgttcaactcgatgactagaatatatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatcgtgactgattaccaggatctactagaagaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtactagaatatatccaggaaaatccctgggaaaaattggaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtagccctacgtaccgtcggtactggtaacgtgaggtcaggttgttcaactcatccaggattagatccgtagatcgtaggaaatatctcggataattaacagatacacacccttagaccatttaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatcgtgactgattaccaggatcctagcggatcctactgacctgacgtacgtaatgcagtggtcaggttgttcaactcgatgactagaatatatccaggaaaatccctgggaaaaattgggccctacgtgtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgacgtttccaggctacacacacactgacagatagacagattcaaattcagtcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatcgtgactgattaccaggatcctagcggatcctactgacctgacgtacgtaatgcagtggtcaggttgttcaactcgatgagaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtactagaatatatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcatatatccaggaaaatccctgggaaaaattggctacgtaccgtattaactaggatctccgatggtacccattaagacacccaaaataggtaacaggtagacatattgatacccatagaggatagatttaggacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatcgtgactgattaccaggatcctagcggatcctactgacctgacgtacgtaatgcagtggtcaggttgttcaactcgatgagaaaaattgggccctacgtaccgtaacgttgtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtactagaatatatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccagctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacgggtactggtaacgtgaggtcaggttgttcaactcatcgtgactgattaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatcgtgactgattaccaggatcctagcggatcctactgacctgacgtacgtaatgcagtggtcaggttgttcaactcgatgagaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtactagaatatatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatcgtgactgattaccaggatcctagcggatcctactgacctgacgtacgtaatgcagtggtcaggttgttcaactcgatgactagaatatatccaggaaaatccctgggaaaaattgggccctacgtgtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcgccttgaatcttggcagtcgtaacgtactagaatatatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcacacacacactgacagagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgcagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgagagtcaggttgttcaactcatcgtgactgattaccaggatcctagcggatcctactgacctgacgtacgtaatgcagtggtcaggttgttcaactcgatgagaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtctagcggatcctactgacctgacgtacgtaatgcagtggtcaggttgttcaactcgatgactagaatatatccaggaaaatccctggactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggca

  • ~1/1,000,000th of the Human Genome

  • Interspersed with genes

  • And “polymorphisms” which differ between people

    • Are sometimes important, influencing traits

    • or medically important characteristics


Sequencing dna l.jpg
Sequencing DNA particular protein a

  • Early techniques were developed in the 1970’s

  • A variety of approaches now exist

  • The biggest limitation to sequencing is that the genome is big

    • So carrying out these reactions for an entire genome is slow and expensive


Next generation sequencing l.jpg
Next Generation Sequencing particular protein a

  • Takes advantage of miniaturization to engage in massively parallel analysis

    • Essentially carrying out millions of sequencing reactions simultaneously in each of 10 million tiny wells

  • Sophisticated computer analysis of huge amounts of information allows “assembly" of a given sequence


Accelerating technology plummeting cost l.jpg
Accelerating Technology & Plummeting Cost particular protein a

Next Generation Sequencing

$795 in 1977

(=$2,800 in current $)


Genomics long term promise l.jpg
Genomics particular protein a ’ Long Term Promise

  • An avalanche of Genome Wide Association Studies (GWAS) in common diseases

  • WGS is now a practical reality

  • Will shed light on the genetic underpinnings of every disease imaginable

Ultimately transforming Medical Science


Medical science medical practice l.jpg
Medical Science = Medical Practice particular protein a

  • Medical Science is the indispensible foundation of Medical Practice

  • But medical practice is far more complex

    • More variables

    • Individual values matter – and they differ

  • Theory alone is insufficient to guide practice

  • Time-line for translation is long

  • Successful translation into practice is not guaranteed by scientific understanding

    • See sickle cell disease

  • It’s far more expensive

  • The stakes are much higher in Medical Practice

    • Because the power to harm is real and potent


  • Where does the clinical promise of genomics lie probably not in risk assessment for common disease l.jpg
    Where Does the Clinical Promise of Genomics Lie? particular protein a Probably not in risk assessment for common disease

    Probably not in simply assessing risk

    • Common diseases have many factors, of which genetics is only one

    • The bulk of any individual’s genetic risk for common disease is modest

      • Thus assessing genetic risk only “nudges” that risk slightly

    • Few data to suggest that knowledge of one’s genomic status for common disease is useful or is effective in changing behavior

    Genetics

    Diabetes

    Diet

    Exercise

    Hypertension

    Smoking


    What s the right nail for sequencing technology l.jpg
    What’s The Right Nail For Sequencing Technology? particular protein a

    • As a diagnostic tool in enigmatic patients

    • As a public health tool to identify those apparently well individuals with dramatically increased risk of preventable disease


    Next generation sequencing as a clinical diagnostic tool l.jpg
    Next Generation Sequencing as a Clinical Diagnostic Tool particular protein a

    • 47 yo female with sudden cardiac arrest

    • Resuscitated successfully

    • EKG reveals “Long QT Syndrome”

      • High risk for sudden death

      • Dozens of genes implicated

    • Application of NGS to detect mutation

    • Thereby guiding patient’s treatment and prevention of death in family members

    ?

    ?

    ?

    ?

    ?


    Next generation sequencing as a public health tool l.jpg
    Next Generation Sequencing as a Public Health Tool particular protein a

    • ~0.25% of US women (375,000) carry a mutation in BRCA1/2

      • At very high risk of breast and ovarian cancer

        • 85% lifetime breast cancer risk

        • 25-50% lifetime ovarian cancer cancer

    • Knowledge of risk allows prevention

      • Currently we only can identify such women once several family members have developed cancer

    • NGS allows population screening for high risk preventable disorders

      • Cancer predisposition, cardiac disease, etc.

      • ~1-2% of population carry such mutations

        • 3-6 million individuals in the US with preventable disorders if identified


    Challenges to harnessing ngs in clinical medicine public health l.jpg
    Challenges to Harnessing NGS in Clinical Medicine & Public Health

    • Accuracy

      • 99.99% accuracy x 3 billion nucleotides

      • = 300,000 errors per patient

    • Interpretation of the variants we find

    • Storage and access in the medical record

    • Education of patients and public

    • Issues of consent and reporting

    • Education of providers


    Incidental information l.jpg
    Incidental Information Health

    • Upon WGS we discover many things we weren't looking for, which we can do nothing about

      • Some are trivial or indeed beneficial

      • But some are problematic

      • And we will occasionally discover lethal, untreatable late onset conditions

    • Some wish to know such information; others do not

    • We must grapple with how to inform patients about such information

      • protect patients from harm but also allow individual autonomy and choice


    In the clinical arena genetic information presents few qualitatively new challenges l.jpg

    Jim Health’s Whole Genome Sequence!!

    ATGGTCCTATGGATCTCTTTAAAGGGCCTTAGTACTTACCGTAACTTTAGCCGGTAGCTTAATCGTGCCTAGGTCGATTGCCTAGGCTTAGCTAGCTTGG

    In the Clinical Arena, Genetic Information Presents Few Qualitatively New Challenges

    Eschewing Genetic Exceptionalism

    • Genetic tests affect others

      • Infectious Disease

    • Provide probabilistic information to the asymptomatic

      • Cholesterol

    • Our genome cannot be changed

      • Nor can much of what we discover medically

    • Insurance discrimination

      • Actually better for genetics than the rest of medicine

    • Unexpected results, FPs/FNs

      • Are a routine part of all clinical care

    • DNA is “uniquely identifiable”

      • Zip code + DOB + spouse’s first name


    Challenges to realizing genomic medicine l.jpg
    Challenges to Realizing Genomic Medicine Health

    Creation of a centralized, evidence-based, iterative process to define clinically significant genomic findings

    Thorough health-oriented phenotypic annotation of variants

    Enabling realistic shared decision making among a range of providers, technology interfaces and patients

    Understanding the ethical dimensions, patient preferences & values regarding returning incidental results

    Maintaining a sober focus on evidence

    Life is short, the art long, opportunity fleeting, experience delusive, judgment difficult


    A human dna sequence24 l.jpg
    A Human DNA Sequence Health

    atcgtgactgattaccaggatcctagcggatcctactgacctgacgtacgtaatgcagtggtcaggttgttcaactcgatgactagaatatatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatcgtgactgattaccaggatctactagaagaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtactagaatatatccaggaaaatccctgggaaaaattggaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtagccctacgtaccgtcggtactggtaacgtgaggtcaggttgttcaactcatccagga/taaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatcgtgactgattaccaggatcctagcggatcctactgacctgacgtacgtaatgcagtggtcaggttgttcaactcgatgactagaatatatccaggaaaatccctgggaaaaattgggccctacgtgtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgacgtttccaggctacacacacactgacagatagacagattcaaattcagtcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatcgtgactgattaccaggatcctagcggatcctactgacctgacgtacgtaatgcagtggtcaggttgttcaactcgatgagaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtactagaatatatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcatatatccaggaaaatccctgggaaaaattggctacgtaccgta/gacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatcgtgactgattaccaggatcctagcggatcctactgacctgacgtacgtaatgcagtggtcaggttgttcaactcgatgagaaaaattgggccctacgtaccgtaacgttgtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtactagaatatatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccagctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacgggtactggtaacgtgaggtcaggttgttcaactcatcgtgactgattaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatcgtgactgattaccaggatcctagcggatcctactgacctgacgtacgtaatgcagtggtcaggttgttcaactcgatgagaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtactagaatatatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatcgtgactgattaccaggatcctagcggatcctactgacctgacgtacgtaatgcagtggtcaggttgttcaactcgatgactagaatatatccaggaaaatccctgggaaaaattgggccctacgtgtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggc/gccttgaatcttggcagtcgtaacgtactagaatatatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcacacacacactgacagagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgaggtcaggttgttcaactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgcagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggcagtcgtaacgtacgtacggtactggtaacgtgagagtcaggttgttcaactcatcgtgactgattaccaggatcctagcggatcctactgacctgacgtacgtaatgcagtggtcaggttgttcaactcgatgagaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtctagcggatcctactgacctgacgtacgtaatgcagtggtcaggttgttcaactcgatgactagaatatatccaggaaaatccctggactcatccaggaaaatccctgggaaaaattgggccctacgtaccgtaacgttgcaaattcagtcggtacgtttccaggctacacacacactgacagatagacagattgtcgtgttatvtgacttggaactgtaggcccttgaatcttggca

    • ~1/1,000,000th of the Human Genome

    • Interspersed with genes

    • And “polymorphisms” which differ between people

      • Are sometimes important, influencing traits

      • or medically important characteristics


    Slide26 l.jpg

    DNA basics Health

    Mx of sequencing

    Key to next gen is massive parallelism and IT

    Graph with drop in cost. Use my computer electronics slide

    Real promise rsrch, drug targets , need to keep a realistic focus; timeline is long,

    Impatience to apply

    Early applications of Genomic technology

    Arrays

    -Clinical Dx

    - consumer application. Slide on DTC with problems. GAO data. RR. Problems slide

    Soon sequencing will supersede arrays

    Clinical Application: real clinical use will be dx Why?

    Genetic heterogeneity examples

    Public health application

    Problems:

    Vast data sets.

    incidental info

    Binning to handle

    Risky info (reintroduce GE here)

    Come back to bin with risk stratification now revealed.

    ?Somewhere: slide on evidence and practice (lidocaine) in context of to understand clinical Sequencing need to understand some important medical principles like EBM

    Use the science not equal to medicine slide.

    Discourage genetic exceptionalism in clinical medicine except where waranted…but we’re used to dealing with privat and complex information.

    Address the fact that clinical genomic testing is very different from research.

    Need focus on evidence

    Finish up with ethical challenges, including IP,



    ad