Question
Download
1 / 72

Question: - PowerPoint PPT Presentation


  • 66 Views
  • Uploaded on
  • Presentation posted in: General

Question:. How do we know where a particular protein is located in the cell?. Cell with fluorescent molecule. Principle of Fluorescence. Experimental Approaches for Protein Localization. 1. Small Molecule Dyes (e.g. DAPI). 2. Immunostaining (dye-conjugated antibodies).

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha

Download Presentation

Question:

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Question:

How do we know where a particular protein

is located in the cell?


Cell with

fluorescent molecule

Principle of Fluorescence


Experimental Approaches

for Protein Localization

1. Small Molecule Dyes (e.g. DAPI)

2. Immunostaining (dye-conjugated antibodies)

3. Green Fluorescent Protein (GFP) “Tagging”


Aequorea victoria


Green Fluorescent Protein (GFP)


GFP

Excitation

Wavelength

(e.g. 490 nm)

Emission

Wavelength

(e.g. 510 nm)


Gene Expression

DNA (Gene X)

Transcription

mRNA

Translation

Protein X


Transcription

Translation

GFP Tagging Approach

DNA (Gene X -GFP “Fusion”)

mRNA

Protein X-GFP “Fusion”


GFP Tagging Experiments

Nuclei

Mitotic Spindle

Tubulin-GFP

Histone-GFP


Question:

Where is the Cdc10 protein located

in a yeast cell?


Septin Protein Family

*


Transcription

Translation

GFP Tagging Approach

DNA (CDC10 -GFP “Fusion”)

mRNA

Cdc10-GFP “Fusion”


Project Overview

Isolation of CDC10 gene Open Reading Frame

Purification of Genomic DNA from yeast

Polymerase Chain Reaction (PCR)

Construction of CDC10-GFP “fusion” gene

Restriction endonuclease/Ligase

Cloning DNA in E. coli

Introduction of CDC10-GFP “fusion” gene

into yeast cells

Observe Cdc10 protein localization

in living cells with fluorescence microscopy


Transcription

Translation

GFP Tagging of Cdc10

DNA (CDC10 -GFP “Fusion”)

mRNA

Cdc10-GFP “Fusion”


Saccharomyces cerevisiae (Yeast)

Eukaryotic cell

15 million bp DNA

~ 6000 genes

Complete genome sequence known!


Lab #1 & 2

Purify genomic DNA

15 million bp

~ 6000 genes

PCR

Copies of

CDC10 Gene

Open Reading Frame

Pg. 350


Taq DNA

Polymerase


Primer

DNA Synthesis

Pg. 202


CDC10 Gene Primers

CDC10-Forward

5’ – GTGGTGAAGCTTATGTCCATCGAAGAACCTAG – 3’

CDC10-Reverse

5’ – GTGGTGAAGCTTTCTAGCAGCAGCAGTACCTGT – 3’


CDC10 Gene

Sequence

(non-template strand sequence)


First Cycle of PCR

5’

3’

Rev

CDC10

3’

5’

5’

3’

(52o C.)

(94o C.)

(72o C.)

For

5’

3’

Pg. 349


Three Cycles of PCR

Pg. 349


Three Cycles of PCR

Pg. 349


Lab #1 & 2

Purify genomic DNA

15 million bp

~ 6000 genes

PCR

Copies of

CDC10 Gene

Open Reading Frame

Pg. 350


Agarose

Gelidium comeum (kelp)


Ethidium Bromide


Lab #1

Purify genomic DNA

15 million bp

~ 6500 genes

PCR

Copies of

CDC10 Gene

Open Reading Frame

Pg. 350


+


+


3’

3’

5’

5’

5’

3’

5’

3’

Restriction Endonuclease Reaction

3’

5’

3’

5’

HindIII (37o C.)


DNA Ligase + ATP (15o C.)

3’

5’

3’

3’

5’

5’

3’

5’

5’

3’

5’

3’

HindIII recognition site is reconstituted

Ligation Reaction

“Compatible” ends

1. Annealing

2. Phosphodiester

bond formation


Construction of a

Recombinant DNA Plasmid

(insert)

Pg. 344


CDC10 Gene Primers

CDC10-For

5’ – GTGGTGAAGCTTATGTCCATCGAAGAACCTAG – 3’

CDC10-Rev

5’ – GTGGTGAAGCTTTCTAGCAGCAGCAGTACCTGT – 3’


GTGGTGAAGCTTATGTCCATCGAAGAA

CACCACTTCGAATACAGGTAGCTTCTT

5’

ACTGCTGCTGCTAGAAAGCTTCACCAC

TGACGACGACGATCTTTCGAAGTGGTG

3’

3’

5’

AGCTTATGTCCATCGAAGAA

ATACAGGTAGCTTCTT

5’

ACTGCTGCTGCTAGAA

TGACGACGACGATCTTTCGA

3’

3’

5’

CDC10 ORF DNA from PCR

HindIII


Ori

AmpR

pGFP Plasmid

HindIII


Ori

AmpR

pGFP Plasmid

AGCTTATGTCCATCGAAGAA

ATACAGGTAGCTTCTT

5’

ACTGCTGCTGCTAGAA

TGACGACGACGATCTTTCGA

3’

3’

5’

HindIII

CDC10 orf


ACT1p

CDC10 orf

GFP orf

HindIII

HindIII

- Thr - Ala - Ala - Ala - Arg - Lys - Leu - Met - Ser - Lys - Gly -

Cdc10

GFP

pCDC10-GFP Plasmid

HindIII Site

ACT GCT GCT GCT AGA AAG CTTATG TCT AAA GGT

5’

3’


DNA Cloning

Bacterial Transformation

(Lab #5)

pCDC10-GFP

Plasmid

Purification (Lab #5)

(AmpR)

(Ampicillin sensitive)

(LB growth medium

with ampicillin)

Pg. 344


DNA Cloning

Plasmid

Purification (Lab #6)

(AmpR)

(LB growth medium

with ampicillin)

Pg. 344


Ori

AmpR

pGFP Plasmid

AGCTTATGTCCATCGAAGAA

ATACAGGTAGCTTCTT

5’

ACTGCTGCTGCTAGAA

TGACGACGACGATCTTTCGA

3’

3’

5’

HindIII

CDC10 orf


Transformation of E. Coli

plasmid


Ori

AmpR

pGFP Plasmid

HindIII


DNA Cloning

pCDC10-GFP

(LB-amp)

(AmpR)

(Ampicillin sensitive)

(LB-amp Plate)

Pg. 344


Transformation of E. Coli

Log Phase Growth

Cold (4oC)

CaCl2

plasmid


E. Coli

Cell Wall

Cell

Membrane

Cytoplasm

(chromosome, plasmids)


Ori

AmpR

pCDCGFP Plasmid

CDC10GFP

HindIII

HindIII


1000 bp

Morning section


1000 bp

Afternoon section


Transformation of Yeast

Linear plasmid


Ori

AmpR

pCDC10GFP Plasmid

CDC10GFP

Selectable

Marker

“Targeting”

sequence


Yeast Chromosome

Chromosome Integration

“Targeting” Locus (RPS10)


Ori

AmpR

pCDC10GFP Plasmid

CDC10GFP

StuI


ACT1p-CDC10GFP

URA3

Linear pCDC10GFP Plasmid

RPS10

RPS10


ACT1p-CDC10GFP

URA3

Yeast Chromosome

Chromosome Integration

Linear pCDCGFP

Plasmid

RPS10


ACT1p-CDC10GFP

URA3

Chromosome Integration

Yeast Chromosome with

CDC10-GFP and URA3 Genes!


URA3 Gene Encodes

Orotidine Decarboxylase

Orotidine Decarboxylase

Uridine Monophosphate

Orotidine Monophosphate

(RNA synthesis)


Yeast ura3 Mutant

Orotidine Decarboxylase

ura3 mutant can NOT make

Uridine Monophosphate

Orotidine Monophosphate


Question:

Where is the Cdc10 protein located

in a yeast cell?


Lab #9

Yeast Transformation Plate

Cells with the

CDC10GFP

“fusion” Gene

URA3 Transformants


ACT1p CDC10GFP

Expression of CDC10GFP “Fusion” Gene

Integrated in

Yeast Chromosome

Transcription/RNA Processing (nucleus)

mRNA (CDC10-GFP orf)

AAAAAA

G

Translation (cytosol)

Cdc10-GFP Protein

Observe Localization of Cdc10-GFP in Yeast Cells


Pg. 10


Light Microscope

(10X)

(10-100X)


GFP

Excitation

Wavelength

(e.g. 490 nm)

Emission

Wavelength

(e.g. 510 nm)


490 nm

510 nm


Nikon TE200 Inverted Microscope


Septin Proteins of Yeast

*

Lipid Bilayer

Binding Domain

http://en.wikipedia.org/wiki/Septins


TEM


Yeast Cells


G2

Yeast Mitotic Cell Cycle

~ 3 Hours


G2

Cdc10 Protein in the

Yeast Mitotic Cell Cycle

Cdc10 marks

site of bud

formation

Cdc10 ring at

the mother/bud

neck

Cdc10 ring

splits into

two

Cdc10

De-polymerizes


ad
  • Login