Question
This presentation is the property of its rightful owner.
Sponsored Links
1 / 72

Question: PowerPoint PPT Presentation


  • 53 Views
  • Uploaded on
  • Presentation posted in: General

Question:. How do we know where a particular protein is located in the cell?. Cell with fluorescent molecule. Principle of Fluorescence. Experimental Approaches for Protein Localization. 1. Small Molecule Dyes (e.g. DAPI). 2. Immunostaining (dye-conjugated antibodies).

Download Presentation

Question:

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Question

Question:

How do we know where a particular protein

is located in the cell?


Question

Cell with

fluorescent molecule

Principle of Fluorescence


Question

Experimental Approaches

for Protein Localization

1. Small Molecule Dyes (e.g. DAPI)

2. Immunostaining (dye-conjugated antibodies)

3. Green Fluorescent Protein (GFP) “Tagging”


Question

Aequorea victoria


Question

Green Fluorescent Protein (GFP)


Question

GFP

Excitation

Wavelength

(e.g. 490 nm)

Emission

Wavelength

(e.g. 510 nm)


Question

Gene Expression

DNA (Gene X)

Transcription

mRNA

Translation

Protein X


Question

Transcription

Translation

GFP Tagging Approach

DNA (Gene X -GFP “Fusion”)

mRNA

Protein X-GFP “Fusion”


Question

GFP Tagging Experiments

Nuclei

Mitotic Spindle

Tubulin-GFP

Histone-GFP


Question

Question:

Where is the Cdc10 protein located

in a yeast cell?


Question

Septin Protein Family

*


Question

Transcription

Translation

GFP Tagging Approach

DNA (CDC10 -GFP “Fusion”)

mRNA

Cdc10-GFP “Fusion”


Question

Project Overview

Isolation of CDC10 gene Open Reading Frame

Purification of Genomic DNA from yeast

Polymerase Chain Reaction (PCR)

Construction of CDC10-GFP “fusion” gene

Restriction endonuclease/Ligase

Cloning DNA in E. coli

Introduction of CDC10-GFP “fusion” gene

into yeast cells

Observe Cdc10 protein localization

in living cells with fluorescence microscopy


Question

Transcription

Translation

GFP Tagging of Cdc10

DNA (CDC10 -GFP “Fusion”)

mRNA

Cdc10-GFP “Fusion”


Question

Saccharomyces cerevisiae (Yeast)

Eukaryotic cell

15 million bp DNA

~ 6000 genes

Complete genome sequence known!


Question

Lab #1 & 2

Purify genomic DNA

15 million bp

~ 6000 genes

PCR

Copies of

CDC10 Gene

Open Reading Frame

Pg. 350


Question

Taq DNA

Polymerase


Question

Primer

DNA Synthesis

Pg. 202


Question

CDC10 Gene Primers

CDC10-Forward

5’ – GTGGTGAAGCTTATGTCCATCGAAGAACCTAG – 3’

CDC10-Reverse

5’ – GTGGTGAAGCTTTCTAGCAGCAGCAGTACCTGT – 3’


Question

CDC10 Gene

Sequence

(non-template strand sequence)


Question

First Cycle of PCR

5’

3’

Rev

CDC10

3’

5’

5’

3’

(52o C.)

(94o C.)

(72o C.)

For

5’

3’

Pg. 349


Question

Three Cycles of PCR

Pg. 349


Question

Three Cycles of PCR

Pg. 349


Question

Lab #1 & 2

Purify genomic DNA

15 million bp

~ 6000 genes

PCR

Copies of

CDC10 Gene

Open Reading Frame

Pg. 350


Question

Agarose

Gelidium comeum (kelp)


Question

Ethidium Bromide


Question

Lab #1

Purify genomic DNA

15 million bp

~ 6500 genes

PCR

Copies of

CDC10 Gene

Open Reading Frame

Pg. 350


Question

+


Question

+


Question

3’

3’

5’

5’

5’

3’

5’

3’

Restriction Endonuclease Reaction

3’

5’

3’

5’

HindIII (37o C.)


Question

DNA Ligase + ATP (15o C.)

3’

5’

3’

3’

5’

5’

3’

5’

5’

3’

5’

3’

HindIII recognition site is reconstituted

Ligation Reaction

“Compatible” ends

1. Annealing

2. Phosphodiester

bond formation


Question

Construction of a

Recombinant DNA Plasmid

(insert)

Pg. 344


Question

CDC10 Gene Primers

CDC10-For

5’ – GTGGTGAAGCTTATGTCCATCGAAGAACCTAG – 3’

CDC10-Rev

5’ – GTGGTGAAGCTTTCTAGCAGCAGCAGTACCTGT – 3’


Question

GTGGTGAAGCTTATGTCCATCGAAGAA

CACCACTTCGAATACAGGTAGCTTCTT

5’

ACTGCTGCTGCTAGAAAGCTTCACCAC

TGACGACGACGATCTTTCGAAGTGGTG

3’

3’

5’

AGCTTATGTCCATCGAAGAA

ATACAGGTAGCTTCTT

5’

ACTGCTGCTGCTAGAA

TGACGACGACGATCTTTCGA

3’

3’

5’

CDC10 ORF DNA from PCR

HindIII


Question

Ori

AmpR

pGFP Plasmid

HindIII


Question

Ori

AmpR

pGFP Plasmid

AGCTTATGTCCATCGAAGAA

ATACAGGTAGCTTCTT

5’

ACTGCTGCTGCTAGAA

TGACGACGACGATCTTTCGA

3’

3’

5’

HindIII

CDC10 orf


Question

ACT1p

CDC10 orf

GFP orf

HindIII

HindIII

- Thr - Ala - Ala - Ala - Arg - Lys - Leu - Met - Ser - Lys - Gly -

Cdc10

GFP

pCDC10-GFP Plasmid

HindIII Site

ACT GCT GCT GCT AGA AAG CTTATG TCT AAA GGT

5’

3’


Question

DNA Cloning

Bacterial Transformation

(Lab #5)

pCDC10-GFP

Plasmid

Purification (Lab #5)

(AmpR)

(Ampicillin sensitive)

(LB growth medium

with ampicillin)

Pg. 344


Question

DNA Cloning

Plasmid

Purification (Lab #6)

(AmpR)

(LB growth medium

with ampicillin)

Pg. 344


Question

Ori

AmpR

pGFP Plasmid

AGCTTATGTCCATCGAAGAA

ATACAGGTAGCTTCTT

5’

ACTGCTGCTGCTAGAA

TGACGACGACGATCTTTCGA

3’

3’

5’

HindIII

CDC10 orf


Question

Transformation of E. Coli

plasmid


Question

Ori

AmpR

pGFP Plasmid

HindIII


Question

DNA Cloning

pCDC10-GFP

(LB-amp)

(AmpR)

(Ampicillin sensitive)

(LB-amp Plate)

Pg. 344


Question

Transformation of E. Coli

Log Phase Growth

Cold (4oC)

CaCl2

plasmid


Question

E. Coli

Cell Wall

Cell

Membrane

Cytoplasm

(chromosome, plasmids)


Question

Ori

AmpR

pCDCGFP Plasmid

CDC10GFP

HindIII

HindIII


Question

1000 bp

Morning section


Question

1000 bp

Afternoon section


Question

Transformation of Yeast

Linear plasmid


Question

Ori

AmpR

pCDC10GFP Plasmid

CDC10GFP

Selectable

Marker

“Targeting”

sequence


Question

Yeast Chromosome

Chromosome Integration

“Targeting” Locus (RPS10)


Question

Ori

AmpR

pCDC10GFP Plasmid

CDC10GFP

StuI


Question

ACT1p-CDC10GFP

URA3

Linear pCDC10GFP Plasmid

RPS10

RPS10


Question

ACT1p-CDC10GFP

URA3

Yeast Chromosome

Chromosome Integration

Linear pCDCGFP

Plasmid

RPS10


Question

ACT1p-CDC10GFP

URA3

Chromosome Integration

Yeast Chromosome with

CDC10-GFP and URA3 Genes!


Question

URA3 Gene Encodes

Orotidine Decarboxylase

Orotidine Decarboxylase

Uridine Monophosphate

Orotidine Monophosphate

(RNA synthesis)


Question

Yeast ura3 Mutant

Orotidine Decarboxylase

ura3 mutant can NOT make

Uridine Monophosphate

Orotidine Monophosphate


Question

Question:

Where is the Cdc10 protein located

in a yeast cell?


Question

Lab #9

Yeast Transformation Plate

Cells with the

CDC10GFP

“fusion” Gene

URA3 Transformants


Question

ACT1p CDC10GFP

Expression of CDC10GFP “Fusion” Gene

Integrated in

Yeast Chromosome

Transcription/RNA Processing (nucleus)

mRNA (CDC10-GFP orf)

AAAAAA

G

Translation (cytosol)

Cdc10-GFP Protein

Observe Localization of Cdc10-GFP in Yeast Cells


Question

Pg. 10


Question

Light Microscope

(10X)

(10-100X)


Question

GFP

Excitation

Wavelength

(e.g. 490 nm)

Emission

Wavelength

(e.g. 510 nm)


Question

490 nm

510 nm


Question

Nikon TE200 Inverted Microscope


Question

Septin Proteins of Yeast

*

Lipid Bilayer

Binding Domain

http://en.wikipedia.org/wiki/Septins


Question

TEM


Question

Yeast Cells


Question

G2

Yeast Mitotic Cell Cycle

~ 3 Hours


Question

G2

Cdc10 Protein in the

Yeast Mitotic Cell Cycle

Cdc10 marks

site of bud

formation

Cdc10 ring at

the mother/bud

neck

Cdc10 ring

splits into

two

Cdc10

De-polymerizes


  • Login