Overview and Context
Download
1 / 9

Drew Endy Stanford Bioengineering The BioBricks Foundation The Presidential Commission for the Study of Bioethical Iss - PowerPoint PPT Presentation


  • 172 Views
  • Uploaded on

Overview and Context of the Technology of Synthethic Biology. Drew Endy Stanford Bioengineering The BioBricks Foundation The Presidential Commission for the Study of Bioethical Issues Washington DC 8 July 2010. Life has not now been created from inanimate matter. Mice from dirty

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Drew Endy Stanford Bioengineering The BioBricks Foundation The Presidential Commission for the Study of Bioethical Iss' - ray


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
Slide1 l.jpg

Overview and Context

of the

Technology of Synthethic Biology

Drew Endy

Stanford Bioengineering

The BioBricks Foundation

The Presidential Commission for the Study of Bioethical Issues

Washington DC

8 July 2010


Slide2 l.jpg

Life has not now been created

from inanimate matter.

Mice from dirty

rags & wheat bran


Slide3 l.jpg

Synthetic living systems,

“Decoupled” promulgation over time,

Replication with representation,

Fashioned selections.

Natural living systems,

Direct generational descent,

Replication with error,

Natural selection.

Synthetic genomes are a BTD (Big Technical Deal)

3


Slide4 l.jpg

Big stresses can arise when material

and information become interconvertible.

- Changes in business and distribution models

(ongoing transitions from CDs & DVDs, to MP3s & Internet TV)

- Challenges to safety & security frameworks

(from control of material, to control of information)

- Avoidance of nation state and cultural relations

(border controls for DNA sequences on the internet, really?)

- Increases in scale and pace (overloading of current practices)

4


Slide5 l.jpg

From absract information to physical, living DNA designs.

2004: 10,000 bp

2010: 1,000,000 bp

DNA Construction = #1 Tech. of 21st Ctry.

TAATACGACTCACTATAGGGAGA

2016: 100 million?


Slide6 l.jpg

~4 meter gap

~99% Genetic Engineering:

<20 kb DNA,

~1 dozen DNA components

Genome Synthesis:

>8 mb DNA, ~1000+ DNA components?!

400-fold “biointegration gap,” today.

(We are relatively bad at putting the molecules of biology back together in useful ways)


Slide7 l.jpg

Beyond synthetic genomes: We’ll need languages & grammars for writing DNA poetry

  • if {growing}

    • call wintergreen()

    • else

    • call bananas()


To have the chance of being ethical we must lead future biotech tool revolutions l.jpg
To Have the Chance of Being Ethical, for writing DNA poetryWe Must Lead Future Biotech. Tool Revolutions

First

Gen.

Biotech

Next

Gen.

Biotech

Adds

New

Tools

Recombinant DNA

Polymerase Chain Reaction

DNA Sequencing

=

=

Basic “Cut” & “Paste”

Amplify & Make Simple Changes

Read Out the Genetic Code

...


The technical ethics of synthetic biology l.jpg

- We often learn best by tinkering. for writing DNA poetry

Today, most of biology remains unknown; we stand to learn

more than ever before via a synthetic approach.

The Technical Ethics of Synthetic Biology

- Freedom of the (DNA) press.

There are now no sustained public investments in getting better

at building DNA; leverage over the presses can lead to

control of content (i.e., what is written).

- Institutions & individuals; hackers are community.

The tools of synthetic biology make biotechnology, today’s *most* compelling

technology, available to many. Do we enable or ostracize a future world of

“Do-It-Together” biotechnology? Let’s not overlook many basics (e.g., property rights).

- Preparedness and reconciliation.

More accidents will happen; more misuses will occur; nature is not a liberal

representative democracy; how do we make such truths not intolerable?


ad