Gene Regulation
This presentation is the property of its rightful owner.
Sponsored Links
1 / 70

Gene regulation and expression in plants- overview Plant development and the environment PowerPoint PPT Presentation


  • 146 Views
  • Uploaded on
  • Presentation posted in: General

Gene Regulation. Gene regulation and expression in plants- overview Plant development and the environment Signal transduction- a general view Regulation of plant genes and transcription factors Light regulation in plants and Phytochrome Light regulated elements Plant growth regulators

Download Presentation

Gene regulation and expression in plants- overview Plant development and the environment

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Gene regulation and expression in plants overview plant development and the environment

Gene Regulation

  • Gene regulation and expression in plants- overview

  • Plant development and the environment

  • Signal transduction- a general view

  • Regulation of plant genes and transcription factors

  • Light regulation in plants and Phytochrome

  • Light regulated elements

  • Plant growth regulators

  • Abscisic acid (ABA) and ABA-responsive genes


Gene regulation and expression in plants overview plant development and the environment

Gene Regulation

  • Regulation of gene expression in plants is essentially the same as in animals.

  • But, the hormones (plant growth regulators) in plants are very different. Also, plant development is profoundly influenced by environment.

  • Therefore, this lecture deals with gene regulation in response to

    1/ light,

    2/ plant growth regulators using absisic acid as an example


Gene regulation and expression in plants overview plant development and the environment

Plants and gene expression

  • Plants undergo chronological changes in morphology and therefore require developmentally regulated gene expression.

  • Plants have organs (not so many as higher animals) and therefore require organ specific gene expression.

  • Plants cannot move their entire body and must therefore respond to changes in the environment. They therefore require environmentally regulated gene expression.


Gene regulation and expression in plants overview plant development and the environment

Plant Development and the Environment

ENVIRONMENTAL STIMULI

Light- intensity, direction, duration

Gravity

Touch

Temperature

Water

Pathogen infection

COMPONENTS OF

ENVIROMENTALLY

REGULATED BEHAVOIUR

Perception

Signal Transduction

Response

RESPONSES TO THE ENVIRONMENT

Nastic Responses

Tropic Responses

Morphogenic Responses

Localised Cellular Responses

Systemic Cellular Responses


Gene regulation and expression in plants overview plant development and the environment

Plant Development and the Environment

  • Nastic Responses- (greek nastos = ‘pressed closed’) typically a non-growth response that is not orientated with regard to the stimulus e.g. closing flower at night, stomatal closure.

  • Tropic Responses- (greek trope = ‘turn’)typically a growth response that is orientated with regard to the stimulus e.g. gravitropism, phototropism.

  • Morphogenic Responses- a response which results in fundamental change in plant metabolism or form e.g. photomorphogenesis.

  • Localised Cellular Responses- small scale changes in cell metabolism e.g. hypersensitive response to pathogens.

  • Systemic Cellular Responses- whole plant changes in cell metabolism e.g. systematic acquired resistance


Gene regulation and expression in plants overview plant development and the environment

Signal Transduction Components

  • Stimulus

    Hormones, physical environment, pathogens

  • Receptor

    On the plasmamembrane, or internal

  • Secondary messengers

    Ca2+, G-proteins, Inositol Phosphate

  • Effector molecules

    Protein kinases or phosphatases

    Transcription factors

  • Response

    Stomatal closure

    Change in growth direction


Gene regulation and expression in plants overview plant development and the environment

Signal transduction

Simplified model

STIMULUS

Plasma

membrane

R

G-prot

Ca2+

Phos

Ca2+

Kin

Nuclear

membrane

R

TF

DNA


Gene regulation and expression in plants overview plant development and the environment

Polyadenylation

signal

CAAT/AGGA box

Distal elements and enhancers

TATA box

Stop codon

TAA,TAG,TGA

TCS (transcription

start site ATG)

Regulation of a Plant Gene

I

I

-1000 -74 bp -54

to -50bp to -16 bp

Promoter

Transcribed untranslated regions

Coding sequence (exons)

Introns

I


Gene regulation and expression in plants overview plant development and the environment

Regulation of transcription:

Transcription factors Bind to RNA polymerase and effect the rate of transcription

Coding region

TATA box

Transcription initiation

RNA Polymerase

Transcription factors


Gene regulation and expression in plants overview plant development and the environment

Light in Plants

We see visible light (350-700 nm)

Plants sense Ultra violet (280) to Infrared (800)

Examples Seed germination - inhibited by light

Stem elongation- inhibited by light

Shade avoidance- mediated by far-red light

There are probably 4 photoreceptors in plants

We will deal with the best understood;

PHYTOCHROMES


Gene regulation and expression in plants overview plant development and the environment

The structure of Phytochrome

A dimer of a 1200 amino acid protein with several domains and 2 molecules of a chromophore.

Chromophore

660 nm

730 nm

Pr Pfr

Binds to membrane


Gene regulation and expression in plants overview plant development and the environment

bZIP

Myb

?

Signal Transduction of Phytochrome

Membrane

Pfr

Ga

G protein a subunit

Pr

Cyclic guanidine monophosphate

Guanylate cyclase

cGMP

Ca2+/CaM

Calmodulin

CAB, PS II

ATPase

Rubisco

FNR

PS I

Cyt b/f

CHS

Anthocyanin synthesis

Chloroplast biogenesis


Gene regulation and expression in plants overview plant development and the environment

-252 -230 -159 -131 +1

IV

III

II

I

Unit 1

5’-CCTTATTCCACGTGGCCATCCGGTGGTGGCCGTCCCTCCAACCTAACCTCCCTTG-3’

bZIP

Myb

Transcription

Factors

Light-Regulated Elements (LREs)

e.g. the promotor of chalcone synthase-first enzyme in anthocyanin synthesis

Promoter has 4 sequence motifs which participate in light regulation.

If unit 1 is placed upstream of any transgene, it becomes light regulated.


Gene regulation and expression in plants overview plant development and the environment

Light-Regulated Elements (LREs)

  • There are at least 100 light responsive genes (e.g. photosynthesis)

  • There are many cis-acting, light responsive regulatory elements

  • 7 or 8 types have been identified of which the two for CHS are examples

  • No light regulated gene has just 1.

  • Different elements in different combinations and contexts control the level of transcription

  • Trans-acting elements and post-transcriptional modifications are also involved.


Gene regulation and expression in plants overview plant development and the environment

Plant growth regulators and their impact on plant development

HormoneResponse

(not a complete list)

AuxinAbscission suppression; apical dominance; cell elongation; fruit ripening; tropism; xylem differentiation

CytokininBud activation; cell division; fruit and embryo development; prevents leaf senescence

GibberellinStem elongation; pollen tube growth; dormancy breaking

Abscisic AcidInitiation of dormancy; response to stress; stomatal closure

EthyleneFruit ripeningand abscission; initiation of root hairs; wounding responses


Gene regulation and expression in plants overview plant development and the environment

CH3

CH3

CH3

OH

COOH

O

CH3

Abscisic Acid (ABA) responsive genes

ABA is involved in two distinct processes

1/ Control of seed development and germination

2/ Stress responses of the mature plant

DROUGHT

IN SALINITYA suite of stress response genes are turned on

COLD

The signal transduction pathway is still poorly understood but certain common regulatory elements have been found in the promoters of ABA responsive genes.


Gene regulation and expression in plants overview plant development and the environment

ABA responsiveness

GUS activity in the presence of ABA related to no ABA

1x

38x

24x

55x

87x

Promoter studies of ABA responsive elements in Barley

Section of the upstream region of a barley ABA responsive gene

CCGGCTGCCCGCCACGTACACGCCAAGCACCCGGTGCCATTGCCACCGG

-104-56

(Shen and Ho 1997)

Reporter

gene (GUS)

Minimal

promoter


Gene regulation and expression in plants overview plant development and the environment

ABA responsive elements

GCCACGTACANNNNNNNNNNNNNNNNNNNNTGCCACCGG--------

ACGCGTCCTCCCTACGTGGC-----------------------------------


Gene regulation and expression in plants overview plant development and the environment

Plant Disease Resistance

  • Importance of pests and pathogens

  • Complete v.s. partial resistance

  • Gene for gene theory

  • Cloned resistance genes

  • A model of Xa21, blight resistance gene

  • The arms race explained


Gene regulation and expression in plants overview plant development and the environment

1988-90

Weeds 13%

Pests 16%

Product

58%

Pathogens

13%

Where does our food go?

The proportion of total production lost due to biotic constraints

1967

Weeds 10%

Pests 11%

Pathogens

12%

Product

67%

We are engaged in a continuous struggle to control weeds, pests and diseases


Gene regulation and expression in plants overview plant development and the environment

Specific molecular

defense mechanisms

Some important pest and pathogens of plants

Pathogens

Fungi

Bacteria

Viruses

Pests

Nematodes

Insects

Vertebrates (not fish!)


Gene regulation and expression in plants overview plant development and the environment

Complete and Partial Resistance

There are two fundamentally different mechanisms of disease resistance.

Partial Resistance

horizontal resistance

Not specific- confers resistance to a range of pathogens

QUANTITATIVE

Complete resistance

vertical resistance

Highly specific (race specific)

Involves evolutionary genetic interaction (arms race)

between host and one species of pathogen.

QUALITATIVE


Gene regulation and expression in plants overview plant development and the environment

Complete resistance

Partial resistance

Frequency %

Frequency %

Disease severity class

Disease severity class

Complete and Partial Resistance

There are two fundamentally different mechanisms of disease resistance.


Gene regulation and expression in plants overview plant development and the environment

Pathogen has virulence (a) and avirulence (A) genes

Plant has resistance gene

rr

RR

A

a

Gene-for-Gene theory of Complete Resistance

If the pathogen has an Avirulence gene and the host a Resistance gene, then there is no infection


Gene regulation and expression in plants overview plant development and the environment

Gene-for-Gene theory of Complete Resistance

The Avirulence gene codes for an Elicitor molecule or protein controlling the synthesis of an elicitor.

The Resistance gene codes for a receptor molecule which ‘recognises’ the Elicitor.

A plant with the Resistance gene can detect the pathogen with the Avirulence gene.

Once the pathogen has been detected, the plant responds to destroy the pathogen.

Both the Resistance gene and the Avirulence gene are dominant


Gene regulation and expression in plants overview plant development and the environment

Gene-for-Gene theory of Complete Resistance

What is an elicitor?

It is a molecule which induces any plant defence response.

It can be a polypeptide coded for by the pathogen avirulence gene, a cell wall breakdown product or low-molecular weight metabolites.

Not all elicitors are associated with gene-for-gene interactions.

What do the Avirulence genes (avr genes) code for?

They are very diverse!

In bacteria, they seem to code for cytoplasmic enzymes involved in the synthesis of secreted elicitor. In fungi, some code for secreted proteins, some for fungal toxins.


Gene regulation and expression in plants overview plant development and the environment

ELICITORS

Elicitors are proteins made by the pathogen avirulence genes, or the products of those proteins

Elicitors of Viruses

Coat proteins, replicases, transport proteins

Elicitors of Bacteria

40 cloned, 18-100 kDa in size

Elicitors of Fungi

Several now cloned- diverse and many unknown function

Elicitors of Nematodes

Unknown number and function


Gene regulation and expression in plants overview plant development and the environment

Gene-for-Gene theory of Complete Resistance

What does a resistance gene code for?

The receptor for the specific elicitor associated with the interacting avr gene


Gene regulation and expression in plants overview plant development and the environment

Protein structure of

cloned resistance genes

Pto

tomato; bacterial resistance

C

N

N

Xa21

rice; bacterial resistance

C

N

Hs1 sugar beet; nematode res.

Cf9, Cf2 tomato; fungal resistance

C

N

L6 flax; fungal resistance

C

RPS2, RMP1 Arabidopsis; bac. res.

N tomato; viral resistance

Prf tomato; bacterial resitance

C

N

Transmembrane domain

Conserved motif

Leucine zipper domain

DNA binding site

Membrane anchor site

Serine/threonine protein

kinase domain

Signal peptide

Leucine-rich repeat


Gene regulation and expression in plants overview plant development and the environment

Model for the action of Xa21

(rice blight resistance gene)

Leucine-rich receptor

Transmembrane domain

Kinase

Membrane

Elicitor

Signal transduction

([Ca2+], gene expression)

Cell Wall

Plant Cell


Gene regulation and expression in plants overview plant development and the environment

The arms race explained

An avirulence genes mutates so that it’s product is no longer recognised by the host resistance gene.

It therefore becomes a virulence gene relative to the host, and the pathogen can infect.

The host resistance gene mutates to a version which can detect the elicitor produced by the new virulence gene.


Gene regulation and expression in plants overview plant development and the environment

Hypersensitive Reaction/Programmed Cell Death

In response to signals, evidence suggests that infected cells produce large quantities of extra-cellular superoxide and hydrogen peroxide which may

1. damage the pathogen

2. strengthen the cell walls Oxidative

3. trigger/cause host cell deathBurst

Evidence is accumulating that host cell also undergo changes in gene expression which lead to cell death

Programmed Cell Death


Gene regulation and expression in plants overview plant development and the environment

Systemic Acquired Resistance

Inducer inoculation

Local acquired resistance

3 days to months,

then inoculate

Systemic acquired resistance

SAR- long-term resistance to a range of pathogens throughout plant caused by inoculation with inducer inoculum


Gene regulation and expression in plants overview plant development and the environment

Similarity with animals

1. Resistance/avirulence gene interaction is analogous to animal antibodies- involves protein-protein binding is highly specific

2. Oxidative burst is analogous to neutrophil action

3. Programmed cell death is common to both plants and animals

4. Systemic acquired resistance is like immunity


Gene regulation and expression in plants overview plant development and the environment

Marker Assisted Selection

  • Targets for crop improvements

  • Genetics of improvement

  • Molecular mapping

  • Mapping a qualitative trait

  • Marker assisted selection for aroma in rice

  • Marker assisted selection for multiple resistant genes

  • Mapping quantitative traits

  • QTLs and marker assisted selection


Gene regulation and expression in plants overview plant development and the environment

Targets for Improvement

Targets for improvement in rice production fall into three categories

Biotic constraints- (pests and diseases)

Weeds, Fungi (e.g. Blast), Bacteria (e.g. Blight), Viruses (e.g. Rice yellow mottle virus), Insects (e.g. Brown plant hopper), Nematodes (e.g. Cyst-knot nematode)

Abiotic constraints (adverse physical environment)

Drought, Nutrient availability, Salinity Cold, Flooding

Yield and quality

Plant morphology, Photosynthetic efficiency, Nitrogen fixation, Carbon partitioning, Aroma


Gene regulation and expression in plants overview plant development and the environment

Genetics of improvement

Biotic constraints-

Qualitative (complete resistance)

Quantitative (partial resistance)

Abiotic constraints-

Quantitative (mostly)

Yield and quality-

Qualitative (aroma, partitioning)

Quantitative (morphology, partitioning)

Requires genetic engineering (photosynthesis, n. fixation)


Gene regulation and expression in plants overview plant development and the environment

Marker Assisted Selection

Useful when the gene(s) of interest is difficult to select for.

1. Recessive Genes

2. Multiple Genes for Disease Resistance

3. Quantitative traits

4. Large genotype x environment interaction


Gene regulation and expression in plants overview plant development and the environment

Molecular Maps

Molecular markers (especially RFLPs and SSRs) can be used to produce genetic maps because they represent an almost unlimited number of alleles that can be followed in progeny of crosses.

Chromosomes with morphological

marker alleles

Chromosomes with molecular

marker alleles

RFLP1b

RFLP1a

RFLP2a

RFLP2b

SSR1b

SSR1a

RFLP3b

RFLP3a

T

t

SSR2b

SSR2a

r

R

RFLP4b

RFLP4a

or


Gene regulation and expression in plants overview plant development and the environment

Molecular map of cross between rice varieties Azucena and Bala. Mapping population is an F6

1

2

3

4

5

6

51 cM

54 cM

54 cM

51 cM

7

8

9

10

11

12

48 cM

MOLECULAR MAPS CAN BE USED TO LOCATE GENES FOR USEFUL TRAITS (CHARACTERISTICS)


Gene regulation and expression in plants overview plant development and the environment

To locate useful genes on chromosomes by linkage mapping, you need

1. A large mapping population (100 + individuals) derived from parental lines which differ in the characteristic or trait you are interested in.

2. Genotype the members of the population using molecular markers which are polymorphic between the parents (e.g. RFLPs, AFLPs, RAPDs)

3. Phenotype the members of the population for the trait making sure you asses each individual as accurately as possible


Gene regulation and expression in plants overview plant development and the environment

What is an F6 mapping population?

Azucena x Bala

F1 (self)1 Individual

F2 F2 F2 F2 F2 (self)205 individuals

F3 F3 F3 F3 F3 (self)205 individuals

F4 F4 F4 F4 F4 (self)205 individuals

F5 F5 F5 F5 F5 (self)205 individuals

F6 F6 F6 F6 F6205 families

Single Seed Decent

Seed multiplication


Gene regulation and expression in plants overview plant development and the environment

R642

RZ141

G320

G44

RG2

C189

G1465

Rice chromosome 11

Making A Linkage Map

Genotype No. of

G320 RG2 C189 Individuals

AAA 47

AAB 8

ABA 5

ABB 15

BAA 19

BBA 24

BAB 3

B B B 42 .

Total 163

Recombinants between G320 and RG2 = 5 + 15 + 19 + 3 = 42 = 26%

Recombinants between RG2 and C189 = 8 + 5 + 24 + 3 = 40 = 25%

Recombinants between G320 and C189 = 8 + 15 + 19 + 24 = 66 = 40%


Gene regulation and expression in plants overview plant development and the environment

A A A

G320 RG2 C189

A A A

B B A

B B A

Frequency of Genotype

47

8

5

15

19

24

3

42

Making a Linkage Map


Gene regulation and expression in plants overview plant development and the environment

Segregation of disease resistance in population

0 1 2 3 4 5 6 7 8 9

Disease Severity Class

Mapping a Qualitative Trait

e.g. disease resistance

For a complete resistance gene, one parent is resistant, the other is susceptible

The individuals in the segregating population are either resistant or susceptible.


Gene regulation and expression in plants overview plant development and the environment

Disease resistant individuals for each genotype

0%

0%

80%

87%

37%

100%

0%

100%

11

R642

RZ141

G320

G44

RG2

C189

G1465

Blast resistance gene

Mapping a Qualitative Trait


Gene regulation and expression in plants overview plant development and the environment

Marker Assisted Selection for Aroma in Rice

The variety Azucena is aromatic (i.e. it smells pleasant and it’s seeds smell and taste pleasant)

Therefore Azucena rice fetches a higher price

The aroma gene is recessive. Therefore, it can’t be followed in backcross breeding.

The gene for aroma has been mapped to chromosome 8

Kalinga III is a popular variety in Eastern India but it is not aromatic.

The aroma gene of Azucena has been crossed into Kalinga III by selection for RFLPs linked to the aroma gene


Gene regulation and expression in plants overview plant development and the environment

Non-selected BC1

Selected BC1

Kalinga III

Azucena

F1

Chromosome 8

Non-selected BC1

G1073

Selected BC1

Kalinga III

Azucena

R2676

F1

Marker Assisted Selection

Using molecular markers as selection criteria rather than the gene you want to transfer

Aroma gene flanked by G1073 and R2676


Gene regulation and expression in plants overview plant development and the environment

Marker Assisted Selection in Disease Resistance

Resistance genes can be selected for by screening with the disease. So, conventional breeding can produce resistant varieties.

But, resistance genes break-down. The disease organism mutates to overcome them (in 2-3 years).

If there were several resistance genes, the disease organism would take very much longer to overcome all resistance genes (in fact it is virtually impossible).

But, you can’t select for say 3 resistance genes conventionally- you can’t tell the difference between 1 gene and 2 or 3 by phenotype.

But if you select for markers linked to the resistance genes, you can introduce multiple resistance genes.


Gene regulation and expression in plants overview plant development and the environment

Marker Assisted Selection in Disease Resistance

Selectable markers

Elite variety Donor1 Donor 2 Donor 3

Multiple crosses followed by backcrossing

with selection for markers at every stage

Elite variety with multiple resistance genes


Gene regulation and expression in plants overview plant development and the environment

11

R642

RZ141

G320

G44

200 250 300 350 400 450 500 550 600 650

Max. Root Length Class (mm)

RG2

C189

G1465

Mapping a Quantitative Trait

e.g. rooting depth

Root length gene


Gene regulation and expression in plants overview plant development and the environment

200 250 300 350 400 450 500 550 600 650

Max. Root Length Class (mm)

Mapping a Quantitative Trait

e.g. rooting depth

Difference between parents is 360 mm

Difference between genotype classes at RG2 is 50 mm

This locus accounts for 16% of the difference


Gene regulation and expression in plants overview plant development and the environment

Quantitative trait loci (QTLs) and Marker Assisted Selection

QTLs (the location of a gene contributing to a quantitatively variable trait) are difficult to select for conventionally;

it is very difficult to identify individuals with the QTL from those without because its effect is small.

Marker assisted selection can be used once markers at the QTL have been found.

Multiple QTLs can be combined for greater effect.


Gene regulation and expression in plants overview plant development and the environment

1

2

3

4

5

6

51 cM

54 cM

54 cM

51 cM

7

8

9

10

11

12

48 cM

Azucena QTLs targeted in the Marker Assisted Selection to improve the root system of Kallinga III


Gene regulation and expression in plants overview plant development and the environment

Genetic Engineering

Genetic transformations

Agrobacterium transformations

Direct transfer methods for transformation

Transformation cassettes

From transformed cells to plants

The use of transformed plants in research

Mutants

Transposon

Transposon and T-DNA tagging


Gene regulation and expression in plants overview plant development and the environment

T-DNA

(transfer)

Restrict and ligate together

Foreign DNA

T-DNA

(transfer)

Re-introduce recombinant DNA

Genetic Engineering of Plants-

Agrobacterium transformation-

The bacteria Agrobacterium tumefaciens causes galls or tumors on plants

Ti Plasmid

(tumor inducing)

Genomic DNA


Gene regulation and expression in plants overview plant development and the environment

Grow up transformed plants from single cells

Whole T-DNA transferred

randomly into plant chromosome

Agrobacterium transformation 2

Infect plant with

recombinant agrobacterium


Gene regulation and expression in plants overview plant development and the environment

Shock of protoplasts

Micro-injection

Biolistics

“GENETIC ENGINEERING” without AGROBACTERIUM

All involve getting DNA directly across the plasma membrane


Gene regulation and expression in plants overview plant development and the environment

Transformation constructs orcassettes

  • Genes of interest

  • Promoter

  • Selectable (marker) gene

Gene of interest

T-DNA

T-DNA

Promoter

e.g. Cauliflower

Mosaic Virus 35S RNA gene promoter

(CAM 35S)

Selectable marker-gene

e.g. antibiotic resistance or herbicide resistance

Allows transgenic cells to be selected from

non-transgenic


Gene regulation and expression in plants overview plant development and the environment

transformation

After transformation, cells grown on selective media (e.g. containing antibiotic)

selection

Untransformed cells die

Transfer to tube with hormones

Cells containing transgenes grow into plantlets

From transformed cells to plants

Plant cells are grown as a callus of undifferentiated cells on agar plates


Gene regulation and expression in plants overview plant development and the environment

Aequorin

Transient increase in luminescence of tobacco plant challenged with fungal elicitor.

Ca2+ involved in pathogen recognition

Luminescence

Tobacco

Time

Transgenic plants as a research tool for non-genetic studies

e.g. aequorin transformed plants to study calcium’s role as secondary messenger

The aequorin gene from a luminescent jellyfish produces a protein aequorin. When combined with a small chromophore, coelentrazine, the complex gives off blue light at a rate dependent on [Ca2+].

When transformed in to tobacco, this gene can be used to study the role of [Ca2+] in signal transduction

Knight et al. 1991


Gene regulation and expression in plants overview plant development and the environment

Untransformed

Transformed

Growth after cold shock relative to control

Transgenic plants to identifying gene function through novel expression eg -3fatty acid desaturase from Arabidopsis in tobacco

  • -3fatty acid desaturase converts 16:2 and 18:2 dienoic fatty acids to 16:3 and 18:3 trienoic acids.

  • A greater degree of fatty acid unsaturation (especially in the chloroplast) was thought to confer greater resistance to cold in plants.

  • Transformation of tobacco (which lacks the enzyme) with the enzyme from Arabidopsis, increases fatty acid unsaturation.

-3fatty acid desaturase transformation confers cold tolerance, confirming that unsaturation is important.


Gene regulation and expression in plants overview plant development and the environment

Transgenic plants to identify gene function through over expression

e.g. over-expression of antioxidant proteins

The Halliwell-Asada pathway

The Halliwell-Asada pathway is important in detoxifying reactive oxygen intermediates. These are produced naturally by the electron-transport chains of mitochondria and especially chloroplasts. Most stresses cause increases in superoxide or hydrogen peroxide production.

Transgenic experiments have investigated the importance of these enzymes in stress resistance.

O2.-

H2O2

H2O

MDHA Ascorbate

DHA

GSSG GSH

NADP+

NADPH

Superoxide Dismutase

Ascorbate peroxidase

Dehydroascorbate

reductase

Glutathione reductase


Gene regulation and expression in plants overview plant development and the environment

Transgenic plants to identify gene function through over expression

e.g. over-expression of antioxidant proteins

Gene ConstructHost Plant Phenotype

Superoxide Dismutase

Chloroplastic TobaccoNo protection from MV or O3

Reduced MV damage and photoinhibition

Reduced MV damage by no protection of photoinhibition

TomatoNo protection from photoinhibition

PotatoReduced MV damage

AlfalfaReduced aciflurofen, freezing and drought damage

MitochondrialTobaccoReduced MV damage in the dark

AlfalfaReduced freezing and drought damage

Cytosolic PotatoReduced MV damage

Ascorbate Peroxidase

CytosolocTobaccoReduced MV damage and photoinhibition

Chloroplastic TobaccoReduced MV damage and photoinhibition

Glutathione Reductase

E. coli in c.plastTobaccoReduced MV and SO2 damage, not O3

PoplarReduced photoinhibition

E. coli in cytosolTobaccoReduced MV damage

PeaTobaccoReduced O3 damage, variable with MV

MV = methyl viologen = paraquat

Allen et al. 1997


Gene regulation and expression in plants overview plant development and the environment

Untransformed

Sense mRNA

Sense and anti-sense mRNAs hybridise in the cytoplasm and cause large reductions in expression

Polygalacturinase

activity

Transformed

Anti-sense mRNA

Time

Transgenic Plants to identifying gene function through gene repression

e.g. polygalacturinase and fruit ripening in tomato

  • Polygalacturinase breaks down cell walls.

  • It’s expression is considerably enhanced in ripening fruit (it makes the fruit soft).

  • Transformation of tomatoes with the anti-sense version (the gene in the opposite direction), reduces the expression of polygalacturinase.

Result- tomatoes don’t soften so quickly- FLAVR SAVR TOMATO


Gene regulation and expression in plants overview plant development and the environment

Transgenic plants to study of promoter function through reporter gene studies

e.g. ABA responsive promoter from barley

Section of the upstream region of a barley ABA responsive gene

CCGGCTGCCCGCCACGTACACGCCAAGCACCCGGTGCCATTGCCACCGG

-104-56

(Shen and Ho 1997)

Reporter

gene (GUS)

Minimal

promoter

ABA responsiveness

GUS activity in the presence of ABA related to no ABA

1x

38x

24x

55x

87x


Gene regulation and expression in plants overview plant development and the environment

The Ac transposable element of maize

11-bp inverted

repeats

Cis-determinants

for excision

Exons of

transposase gene

Introns

Mutants and Plant Genetics

DNA damage- X and Gamma rays, sodium azide (NaN3)

Transposons and T-DNA tagging

A transposon can move at random throughout a plant genome. It is cut out of its site and reinserted into another site by the action of an endonuclease and the transposase.

Insertion into a functional gene causes mutation.


Gene regulation and expression in plants overview plant development and the environment

Screen

Identify mutated

gene

Transposons and T-DNA tagging

Transposons have only been found in a few plants (e.g. Maize, Antirrhium). But, they can be introduced by transformation. The Ac transposon has been introduced to tobacco, Arabidopsis, potato, tomato, bean and rice.

Mutations using transposons or T-DNA (both of which insert randomly into nuclear DNA) are produced by transformation methods described earlier. Large numbers of plants are screened for an observable phenotype (e.g. lack of response to light).


Gene regulation and expression in plants overview plant development and the environment

Restrict

PCR amplify using primers homologous to and facing out of insert

Ligate

Transposons and T-DNA tagging

The gene into which the insert has occurred can be recovered by PCR

Insertion (Transpososn or T-DNA)

Mutated ORF


  • Login