Mlpa multiplex ligation dependent probe amplification
This presentation is the property of its rightful owner.
Sponsored Links
1 / 39

MLPA ( Multiplex ligation – dependent probe amplification ) PowerPoint PPT Presentation


  • 190 Views
  • Uploaded on
  • Presentation posted in: General

MLPA ( Multiplex ligation – dependent probe amplification ). Peter Böhm Nielsen. Generelt analyseflow. MLPA. Anvendte metoder. HRM & Sanger sekventering. Allel 1. Allel 2. Allel 1. MLPA (Multiplex Ligation-dependent Probe Amplification). Allel 2.

Download Presentation

MLPA ( Multiplex ligation – dependent probe amplification )

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Mlpa multiplex ligation dependent probe amplification

MLPA(Multiplexligation – dependent probeamplification)

Peter Böhm Nielsen


Generelt analyseflow

Generelt analyseflow

MLPA


Anvendte metoder

Anvendte metoder

HRM & Sanger sekventering

Allel 1

Allel 2

Allel 1

MLPA (Multiplex Ligation-dependent Probe Amplification)

Allel 2


Multiplex ligation dependent probe amplification mlpa

Multiplex Ligation-Dependent Probe Amplification (MLPA)

  • MLPA er en teknik til kopitalsbestemmelse af specifikke sekvenser. Dette sker ved simultan binding af op til 45 prober, hvorefter det relative antal af bundne prober bestemmes.

  • Til udførelsen benyttes PCR amplifikation.


Mlpa probe hybridisering

MLPA Probehybridisering

1

Promoter Exon 1 Intron 1 Exon 2 Intron 2 Exon 3

2

Promoter Exon 1 Intron 1 Intron 2 Exon 3


Mlpa 1 multiplex ligation depending probe amplification

MLPA (1)MultiplexLigationdependingProbeAmplification

  • Denaturering

  • Hybridisering

  • Ligering

  • Amplifikation

  • Fragment-analyse


Salsa mlpa prober

SALSA MLPA prober


Hybridisering

Hybridisering

  • MLPA probemixblandes med denatureretgenomisk DNA.

  • De to sammenhørende prober hybridiserestiltilstødende target sekvenser


Ligering

Ligering

3. Prober ligeressammenaf en thermostabilligase.


Amplifikation

Amplifikation

  • Et universelt primer par benyttestilamplifikationafalleligerede prober.

    Hvertamplifikatfrahver probe har en uniklængde (130 - 480 bp).


Separation og kvantitering ved kapill r elektroforese

Separation ogkvantiteringvedkapillærelektroforese

Hver top er et amplifikatfra en specifik probe .

Prøvernesammanlignes med en kontrolprøve.

En forskelirelativtophøjde/areal indikerer en ændringikopitalaf den gældende probes target sekvens.


Mlpa multiplex ligation dependent probe amplification

MLPA


Mlpa multiplex ligation dependent probe amplification

MLPA


Mlpa multiplex ligation dependent probe amplification

MLPA


Mlpa multiplex ligation dependent probe amplification

MLPA


Mlpa multiplex ligation dependent probe amplification

MLPA


Normal mlpa

Normal MLPA


Mlpa deletion af exon 5 7

MLPA Deletion af exon 5-7


Mlpa deletion af exon 3 16

MLPA Deletion af exon 3-16


Mlpa duplikation af exon 13

MLPA Duplikation af exon 13


Hvad kan dette v re

Hvad kan dette være ?


Kan dette v re rigtigt

Kan dette være rigtigt ?

Det er ikke sandsynligt at ovenstående er deletioner, da proberne mellem de 2 exons har korrekt amplifikationsstatus.


Mlpa probe hybridisering 2

MLPAProbehybridisering (2)

Stuffer sekvens

OH

P

ACGTACGCACCT

CCTTGATTTGGAC

AGTTGGAACTAAACCTGTGCATGCGTGGATTTC

Gen specifikke prober

Kontroller

Prober forsøges designet udenfor SNP’s


Mlpa prober eksempler

MLPA prober - eksempler


Anvendte metoder1

Anvendte metoder

HRM & Sanger sekventering

Allel 1

Allel 2

Allel 1

MLPA (Multiplex Ligation-dependent Probe Amplification)

Allel 2


Materialer og metoder cish og fish for her 2 amplifikation 1

Materialer og metoder CISH og FISH for HER-2 amplifikation (1)


Materialer og metoder cish og fish for her 2 amplifikation 2

Materialer og metoder CISH og FISH for HER-2 amplifikation (2)

Farshid.


Materialer og metoder pr vemateriale 1

Materialer og metoder (Prøvemateriale (1))


Materialer og metoder pr vemateriale 2 hematoxylin og eosin farvning he

Materialer og metoder (Prøvemateriale (2))Hematoxylin og eosin-farvning (HE)

Cancerceller kan ”fortyndes” i normale celler

Hvad har det af betydning ?


Resultater normal

ResultaterNormal


Resultater amplificeret

Resultater Amplificeret


Resultater mlpa vs ish

ResultaterMLPA vs. ISH


Kvalitetssikring af resultatet quantity peaks

Kvalitetssikring af resultatet Quantity-peaks

Q-peaks: 64, 72, 76 & 82 – indikerer DNA mængde

Uafhængig af ligering


Kvalitetssikring af resultatet denaturing peaks

Kvalitetssikring af resultatet Denaturing-peaks

TE TE+50mM NaCl TE+75mM NaCl

D-peaks: 88, 92 & 96 – indikerer DNA kvalitet og ligerings-reaktion

Afhængig af DNA &ligering

D-prober er placeret tæt på CpG-island – kræver meget energi ved denatureringen


Raw data vurdering sloping

Raw-data vurdering (sloping)

God amplifikation

Uensartet amplifikation

Resultater med samme signal-niveau er bedst at sammenligne.

Sloping er OK til et vist punkt, hvis normalisering kan udføres.

Kan skyldes fordampning – test med 8µl vand.


Rawdata vurdering

Rawdata vurdering


Skuldre

”Skuldre”

Degradering af ligerede prober: Kør MLPA-analysen direkte efter fortynding i formamid


  • Login