1 / 43

Translation: Changing languages

How?. Why?. Transcription: Writing again. Translation: Changing languages. Last lab we went from here. To here. We can do anything. Text. Today, we’ll add in more of the details about HOW this happens. Review Vocabulary. Genes = long strand of DNA

rafiki
Download Presentation

Translation: Changing languages

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. How? Why? Transcription: Writing again Translation: Changinglanguages

  2. Last lab we went from here... To here We can do anything Text Today, we’ll add in more of the details about HOW this happens

  3. Review Vocabulary • Genes = long strand of DNA • Gene = all the information for making a protein including WHERE and WHEN to make the protein • WHOLE POINT OF TODAY – add more details to our understanding of how the information in the gene (DNA) gets extracted so that the protein can be made

  4. Off to see the wizard... Sending ‘messages’ out from DNA • DNA replication • both strands => new DNA • => new cell • Transcription • 1 strand => new RNA • => new protein

  5. Transcription: seeing it http://www.hhmi.org/biointeractive/dna-transcription-basic-detail

  6. Transcription • What part of the recipe analogy did transcription correlate to?

  7. WHERE did the photo copy of the recipe get made? • WHERE does the mRNA copy get made??

  8. Amino acids • From 4 letters of storage/information • to • 20 letters of action!!

  9. Nucleotides vs. Amino Acids • Why do nucleotides look like nucleotides, while amino acids look like amino acids?

  10. Different tools; different jobs • In what ways are all nucleotides identical? Different? https://meyerbio1b.wikispaces.com/•Nucleic+Acids

  11. Different tools; different jobs • In what ways are all amino acids identical? Different?

  12. Different tools; different jobs • Which set is more diverse in terms of ‘feel’? • Which more diverse in terms of shape? • Which would allow you to build more diverse shapes & surfaces? https://meyerbio1b.wikispaces.com/•Nucleic+Acids

  13. Nucleotides vs. Amino Acids • Why do nucleotides look like nucleotides, while amino acids look like amino acids? • What are amino acids ‘for’? • What are nucleotides ‘for’?

  14. Point to be made • DNA is for storing information, so the bases being rigid and specific in the fact that they can only interact with ‘their’ partner means they are good molecules for storing information • Proteins are for ‘doing stuff’ so it makes sense they are made out of diverse molecules

  15. How does a codon ‘mean’ an amino acid?

  16. Walking the walk • How bio machines translate the language of nucleotides (DNA) into an amino acid string (proteins)

  17. Types of bonds • VELCRO: a bond that can be cheerfully broken/re-made during lab • Duct tape: same at the molecular level, but at the 184/181L student level, breaking such a bond gets you a zero on this week’s quiz

  18. Blinding you with Science (vocab) • RNA Polymerase: joins RNA links into a chain mRNA: messenger RNA; RNA string copied (‘transcribed’) from DNA • tRNA: transfer RNA; one of many RNA molecules that carry specific amino acids • ribosome: giant machine (>200 proteins, 4 RNAs (2 > 1000 nucleotides) that oversees the reading of the mRNA and the creation of polypeptide • aminoacyltRNAsynthetase: protein machine adds amino acid to tRNAs • Termination factor: ‘reads’ UAA etc., => ribosome looses the peptide & falls apart • ***Should this be a TA slide or should this be a student slide?

  19. DNA template strand 5’ CTTAAATCCGAATGCCCATG 3’

  20. DNA template strand(alternate version) 5’ CTTAAATCCGAATGCCCATG 3’ 5’ end is pointy/spiky 3’ end is soft/furry

  21. Roles--for single mRNA 5’ end is pointy/spiky 3’ end is soft/furry • 8tRNA – Angel, Jose, Grace, Emily, Jessenia, Kimberly, Mason • 4 synthetases – Samantha, Kathryn, Don, Genevive, • 3 mRNA and RNA polymerase – Jessie, Rachel , Onur • Ribosome (small + large ribosomal subunit) – David, Megan (small subunit), Stacie, Joe (large subunit) • 1 -2 termination factor/release factor – Jessi, Robert, • Watchers - Michael, Ryan, Sofia (write out what you are noticing happening and what you find confusing)

  22. Learning your ‘lines’ • Handout: Each group find questions related to their role; answer them • Lab manual, textbook, internet OK as sources • Meet your blocks-- 5’ is the end that sticks to hair, socks, shirts • You will need these for the quiz at the end of class – each INDIVIDUAL should write the answers for their specific role 5’ end is pointy/spiky 3’ end is soft/furry

  23. Special powers • Recall that ribosome assembly is the result of methionine tRNA finding a match on mRNA in presence of small ribosome subunit • Only methionine tRNA (it will ‘know itself’ once crowned by the synthetase that hands out met) can team with small ribosomal subunit & join with the ‘AUG’!

  24. Choreographing translation • A play of many parts, many players, no brains • -Its all about feel!

  25. Going with the flow • mRNA at the central bench • ribosome assembles around it • synthetases at bench corners (or ‘diffuse’ opp. direction vs. tRNA) • tRNAs will ‘diffuse’ by following a path through the room • When any event first happens*, action stops, molecules involved will announce, explain • Go until a protein happens *This includes non-events (rejections, etc.)

  26. Walk-through with 1 tRNA • Everybody watches visits to synthetase, ribosome • In the real world, everything is happening all the time; all is happenstance

  27. Explain to your group • Each group will have at least one person from each role • You are responsible for explaining your role to the rest of the group • The group as a whole is responsible for understanding how the different players (roles) work together to bring about translation • At the end of class you will work in pairs on a ‘partner’ quiz to explain the process of translation. You can use the notes from this group discussion, but nothing else

  28. Who knows the code? - • What happens if a tRNA carries the wrong amino acid? • Think back to what you just saw – what if the synthetase messed up and matched the wrong amino acid to the wrong tRNA? Would any of the ‘players’ know the • What happens if a tRNA has a mutated anticodon? (there are a number of ‘correct’ answers to this question)

  29. Where we’ve been: • DNA replication • DNA transcription • Translation

  30. What if the DNA sequence was changed somehow? • What would the consequence be for DNA replication? • What about transcription/translation?

  31. Stuff happens (baaaad stuff) http://www.nature.com/scitable/nated/content/ne0000/ne0000/ne0000/ne0000/97271/pierce_17_11_FULL.jpg

  32. Things left out in water(and oxygen) http://simple.wikipedia.org/wiki/File:Rust.rost.JPG http://upload.wikimedia.org/wikipedia/commons/6/6e/Statue_of_Liberty_frontal_2.jpg

  33. Deamination (more bad stuff) http://oregonstate.edu/instruct/bb451/winter09/stryer6/CH28/figure28-37.jpg

  34. Uracil Cytosine

  35. What would the consequences be? Uracil Cytosine

  36. Consequences… http://bio3400.nicerweb.com/Locked/media/ch15/15_04-deamination.jpg

  37. Show ‘Wesplication’ movie • Actually, not sure if this is even necessary any more – I’ve changed the focus of the questions in base pairer to better reflect the emphasis the labs now have

  38. 1st step in cell replication is DNA replication

  39. Consequences: • Think back to the recipe analogy: What would have happen if the copy of the book that your book had been made from had an error? • What is the consequence of a change in the DNA sequence? • If you wanted to give a copy of your ‘error-ed’ book to your child? • What does that mean about every new cell that gets a copy of that initially changed DNA? • What does that mean about every protein that is eventually made from the changed DNA?

  40. Other consequences: • What if something happens when you are making a photo copy of the one recipe and just that recipe has an error? • What would happen if a mistake was made when the mRNA was being copied from the DNA? • What would that mean for each protein made from the flawed mRNA?

  41. Review movie • (in TA desktop folder) • http://www.hhmi.org/biointeractive/translation-basic-detail • If you have time, it would be good to get the students to point out the things that were wrong (like the fact that every tRNA fits perfectly the first time)

  42. Pairs Quiz • 1.) Write your names and SECTION at the top of the paper • 2.) EXPLAIN the process of TRANSLATION • Include the following in your answer: • The role of diffusion/Brownian motion • how the players ‘know’ that they have found the right partner/location • tRNA • mRNA & RNA polymerase • Ribosome (small and large subunits) • ‘start’ codon • ‘stop’ codon • aminoacyltRNAsynthetase • termination factor/release factor

  43. Homework – Base Pairer part 2, Translation and Mutation, Intro to Evolution

More Related