Biology i
This presentation is the property of its rightful owner.
Sponsored Links
1 / 33

Biology I PowerPoint PPT Presentation


  • 44 Views
  • Uploaded on
  • Presentation posted in: General

Biology I. Chapter 11—DNA: The Molecule of Heredity. Chapter 11 Section 2: From DNA to Protein. DNA has the info to make all proteins for an organism in code . The instructions have to be decoded so the cell can build the needed proteins. Section 2 Objectives – page 288.

Download Presentation

Biology I

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Biology i

Biology I

  • Chapter 11—DNA: The Molecule of Heredity


Chapter 11 section 2 from dna to protein

Chapter 11 Section 2: From DNA to Protein

  • DNA has the info to make all proteins for an organism in code.

  • The instructions have to be decoded so the cell can build the needed proteins.


Section 2 objectives page 288

Section 2 Objectives – page 288

Chapter 11 Section 2 Objectives

  • Relate the concept of the gene to the sequence of nucleotides in DNA.

  • Sequence the steps involved in the first part of protein synthesis, called “transcription”.

  • Sequence the steps involved in the second part of protein synthesis, called “translation”.


Section 2 part 1 vocabulary

Section 2 Part 1 Vocabulary

  • Messenger RNA

  • Ribosomal RNA

  • Transfer RNA

  • Transcription

  • Codon


Section 11 2 summary pages 288 295

Section 11.2 Summary – pages 288 - 295

Genes and Proteins

  • As we previously learned, your DNA contains information that codes for the production of _____________________

proteins

  • Small nucleotide sequences in your DNA, called _________, code for the production of ___________ proteins

genes

different


Biology i

  • Genes line up along your DNA almost like the cars in a __________

  • Human DNA contains approximately ____________ genes

train

30,000


Section 11 2 summary pages 288 2951

Section 11.2 Summary – pages 288 - 295

  • In chapter 6, we learned that proteins are polymers made up of subunits called _____________________

  • Once fully made, proteins fold into complex, ____ - dimensional shapes

amino

acids

3


Section 11 2 summary page 288 295

Section 11.2 Summary – page 288 - 295

  • Proteins are made at __________________

ribosomes

What/where are ribosomes in your cells?

Little dots

in the cytoplasm

or on the ER


Section 11 2 summary page 288 2951

Section 11.2 Summary – page 288 - 295

Where is your DNA in a cell?

In the

nucleus

So, to make a protein, the information inside of your ___________ must somehow get to a ______________

nucleus

ribosome


Biology i

damaged

  • DNA cannot leave the nucleus because it could get _______________

  • Instead, another nucleic acid called __________, makes a copy of your genetic information for use by the cell when assembling ____________.

RNA

proteins


Biology i

  • What does RNA stand for?

  • There are three types of RNA…each has a specific job during Protein Synthesis.

    • _________________________

    • _________________________

    • _________________________

  • There are ____ differences between DNA and RNA

Ribonucleic acid

Messenger RNA (mRNA)

Ribosomal RNA (rRNA)

Transfer RNA (tRNA)

3


Section 11 2 summary pages 288 2952

Section 11.2 Summary – pages 288 - 295

Difference #1

  • RNA is ________ stranded—it looks like one-half of a zipper

  • DNA is ________ stranded

single

double

RNA nucleotide


Section 11 2 summary pages 288 2953

Section 11.2 Summary – pages 288 - 295

Difference #2

Ribose

  • The sugar in RNA is ___________

  • DNA’s sugar is _________________

ribose

deoxyribose


Section 11 2 summary pages 288 2954

Section 11.2 Summary – pages 288 - 295

Difference #3

  • Both DNA and RNA have ____ nitrogenous bases, but RNA contains ____________ instead of ____________

4

Uracil (U)

Thymine (T)

  • ___ base pairs with ____ in RNA

U

A

Uracil

Hydrogen bonds

Adenine


Biology i

  • The first step in making a protein is called ________________

    • Occurs in the __________

    • The cell uses enzymes to make a copy of DNA that is called _________ RNA (mRNA)

transcription

nucleus

messenger


Transcription step 1 dna

Transcription Step 1 – DNA_________

opens up

Nucleus

A T

T A

C G

G C

A T

DNA DNA


Transcription step 2 strand of mrna is formed

One

Transcription Step 2 – ____ strand of mRNA is formed

Nucleus

A T

T A

C G

G C

A T

U

A

G

C

U

DNA DNA


Transcription step 3 mrna is

Transcription Step 3 – mRNA is ________

processed

  • Not every portion of DNA is used to make proteins

    • Long noncoding regions are called __________ for _________________.

    • Regions containing coding information are called __________ for _______________.

    • ____________ cut out the introns and paste the __________ back together

introns

Intervening areas

exons

Expressed areas

Enzymes

exons


Biology i

  • After enzymes cut out the introns, how would this strand of mRNA read?

    GUCUAGUCGAAUCGCGAUGCACCC

Exon

Exon

Exon

Intron

Intron

Intron

GUC GCG CCC


Translation step 1 mrna moves of the nucleus into the cytoplasm to a

Translation Step 1 – mRNA moves ____ of the nucleus into the cytoplasm to a ______________

out

ribosome

Nucleus

A T

T A

C G

G C

A T

U

A

G

C

U

  • Ribosome

UAGCU

DNA DNA


Translation step 2

Translation: Step 2

  • The amino acids that mRNA codes for will be brought to a ________________ by ___________ RNA where they will be put together to make a _____________

ribosome

transfer

protein


Biology i

  • Transcription & Translation Video


Section 11 2 summary pages 288 2955

Section 11.2 Summary – pages 288 - 295

  • There are ___ common amino acids that can be put together in different ways to make different proteins

  • Each group of ___ nitrogenous bases on mRNA codes for an amino acid

    • These groups are called ___________

    • Circle the codons in the mRNA strand below

      AUGACGAACUGA

20

3

codons


Section 11 2 summary pages 288 2956

Section 11.2 Summary – pages 288 - 295

Methionine

(Start)

What amino acid does AUG code for?

The Messenger RNA Genetic Code

First Letter

Third Letter

Second Letter

U

A

G

C

U

U

Phenylalanine (UUU)

Serine (UCU)

Tyrosine (UAU)

Cysteine (UGU)

C

Cysteine (UGC)

Phenylalanine (UUC)

Serine (UCC)

Tyrosine (UAC)

A

Stop (UGA)

Serine (UCA)

Stop (UAA)

Leucine (UUA)

G

Leucine (UUG)

Serine (UCG)

Stop (UAG)

Tryptophan (UGG)

C

U

Arginine (CGU)

Leucine (CUU)

Proline (CCU)

Histadine (CAU)

Arginine (CGC)

Proline (CCC)

C

Leucine (CUC)

Histadine (CAC)

A

Proline (CCA)

Arginine (CGA)

Leucine (CUA)

Glutamine (CAA)

Arginine (CGG)

G

Glutamine (CAG)

Proline (CCG)

Leucine (CUG)

A

U

Isoleucine (AUU)

Threonine (ACU)

Asparagine (AAU)

Serine (AGU)

C

Serine (AGC)

Asparagine (AAC)

Isoleucine (AUC)

Threonine (ACC)

A

Arginine (AGA)

Isoleucine (AUA)

Threonine (ACA)

Lysine (AAA)

G

Arginine (AGG)

Methionine;Start (AUG)

Threonine (ACG)

Lysine (AAG)

G

Glycine (GGU)

U

Valine (GUU)

Alanine (GCU)

Aspartate (GAU)

Valine (GUC)

Aspartate (GAC)

Glycine (GGC)

Glycine (GGC)

C

Alanine (GCC)

A

Glycine (GGA)

Alanine (GCA)

Glutamate (GAA)

Valine (GUA)

Glutamate (GAG)

Glycine (GGG)

Alanine (GCG)

G

Valine (GUG)


Section 11 2 summary pages 288 2957

Section 11.2 Summary – pages 288 - 295

What amino acid does ACG code for?

threonine

The Messenger RNA Genetic Code

First Letter

Third Letter

Second Letter

U

A

G

C

U

U

Phenylalanine (UUU)

Serine (UCU)

Tyrosine (UAU)

Cysteine (UGU)

C

Cysteine (UGC)

Phenylalanine (UUC)

Serine (UCC)

Tyrosine (UAC)

A

Stop (UGA)

Serine (UCA)

Stop (UAA)

Leucine (UUA)

G

Leucine (UUG)

Serine (UCG)

Stop (UAG)

Tryptophan (UGG)

C

U

Arginine (CGU)

Leucine (CUU)

Proline (CCU)

Histadine (CAU)

Arginine (CGC)

Proline (CCC)

C

Leucine (CUC)

Histadine (CAC)

A

Proline (CCA)

Arginine (CGA)

Leucine (CUA)

Glutamine (CAA)

Arginine (CGG)

G

Glutamine (CAG)

Proline (CCG)

Leucine (CUG)

A

U

Isoleucine (AUU)

Threonine (ACU)

Asparagine (AAU)

Serine (AGU)

C

Serine (AGC)

Asparagine (AAC)

Isoleucine (AUC)

Threonine (ACC)

A

Arginine (AGA)

Isoleucine (AUA)

Threonine (ACA)

Lysine (AAA)

G

Arginine (AGG)

Methionine;Start (AUG)

Threonine (ACG)

Lysine (AAG)

G

Glycine (GGU)

U

Valine (GUU)

Alanine (GCU)

Aspartate (GAU)

Valine (GUC)

Aspartate (GAC)

Glycine (GGC)

Glycine (GGC)

C

Alanine (GCC)

A

Glycine (GGA)

Alanine (GCA)

Glutamate (GAA)

Valine (GUA)

Glutamate (GAG)

Glycine (GGG)

Alanine (GCG)

G

Valine (GUG)


Section 11 2 summary pages 288 2958

Section 11.2 Summary – pages 288 - 295

What amino acid does AAC code for?

Asparagine

The Messenger RNA Genetic Code

First Letter

Third Letter

Second Letter

U

A

G

C

U

U

Phenylalanine (UUU)

Serine (UCU)

Tyrosine (UAU)

Cysteine (UGU)

C

Cysteine (UGC)

Phenylalanine (UUC)

Serine (UCC)

Tyrosine (UAC)

A

Stop (UGA)

Serine (UCA)

Stop (UAA)

Leucine (UUA)

G

Leucine (UUG)

Serine (UCG)

Stop (UAG)

Tryptophan (UGG)

C

U

Arginine (CGU)

Leucine (CUU)

Proline (CCU)

Histadine (CAU)

Arginine (CGC)

Proline (CCC)

C

Leucine (CUC)

Histadine (CAC)

A

Proline (CCA)

Arginine (CGA)

Leucine (CUA)

Glutamine (CAA)

Arginine (CGG)

G

Glutamine (CAG)

Proline (CCG)

Leucine (CUG)

A

U

Isoleucine (AUU)

Threonine (ACU)

Asparagine (AAU)

Serine (AGU)

C

Serine (AGC)

Asparagine (AAC)

Isoleucine (AUC)

Threonine (ACC)

A

Arginine (AGA)

Isoleucine (AUA)

Threonine (ACA)

Lysine (AAA)

G

Arginine (AGG)

Methionine;Start (AUG)

Threonine (ACG)

Lysine (AAG)

G

Glycine (GGU)

U

Valine (GUU)

Alanine (GCU)

Aspartate (GAU)

Valine (GUC)

Aspartate (GAC)

Glycine (GGC)

Glycine (GGC)

C

Alanine (GCC)

A

Glycine (GGA)

Alanine (GCA)

Glutamate (GAA)

Valine (GUA)

Glutamate (GAG)

Glycine (GGG)

Alanine (GCG)

G

Valine (GUG)


Section 11 2 summary pages 288 2959

Section 11.2 Summary – pages 288 - 295

What does UGA code for?

Stop

The Messenger RNA Genetic Code

First Letter

Third Letter

Second Letter

U

A

G

C

U

U

Phenylalanine (UUU)

Serine (UCU)

Tyrosine (UAU)

Cysteine (UGU)

C

Cysteine (UGC)

Phenylalanine (UUC)

Serine (UCC)

Tyrosine (UAC)

A

Stop (UGA)

Serine (UCA)

Stop (UAA)

Leucine (UUA)

G

Leucine (UUG)

Serine (UCG)

Stop (UAG)

Tryptophan (UGG)

C

U

Arginine (CGU)

Leucine (CUU)

Proline (CCU)

Histadine (CAU)

Arginine (CGC)

Proline (CCC)

C

Leucine (CUC)

Histadine (CAC)

A

Proline (CCA)

Arginine (CGA)

Leucine (CUA)

Glutamine (CAA)

Arginine (CGG)

G

Glutamine (CAG)

Proline (CCG)

Leucine (CUG)

A

U

Isoleucine (AUU)

Threonine (ACU)

Asparagine (AAU)

Serine (AGU)

C

Serine (AGC)

Asparagine (AAC)

Isoleucine (AUC)

Threonine (ACC)

A

Arginine (AGA)

Isoleucine (AUA)

Threonine (ACA)

Lysine (AAA)

G

Arginine (AGG)

Methionine;Start (AUG)

Threonine (ACG)

Lysine (AAG)

G

Glycine (GGU)

U

Valine (GUU)

Alanine (GCU)

Aspartate (GAU)

Valine (GUC)

Aspartate (GAC)

Glycine (GGC)

Glycine (GGC)

C

Alanine (GCC)

A

Glycine (GGA)

Alanine (GCA)

Glutamate (GAA)

Valine (GUA)

Glutamate (GAG)

Glycine (GGG)

Alanine (GCG)

G

Valine (GUG)


Transcription steps 3 5

Transcription: Steps 3-5

3. Amino acids hook up using_________ bonds, which connect ________ & ________.

4. Once AAs are in place, the _______ leaves to pick up another _______ ______.

5. Once the _____ codon is reached, the new _______ strand leaves the ________ and moves into the ____ for distribution to other areas of the cell.

peptide

carbon

nitrogen

tRNA

amino acid

stop

protein

ribosome

ER


Section 2 vocabulary review

Section 2 Vocabulary Review

  • Messenger RNA— carries info from DNA in nucleus into the cytoplasm

  • Ribosomal RNA—connects with mRNA, uses the info on it to assemble amino acids in proper order

  • Transfer RNA—delivers amino acids to ribosomes to be linked together into proteins


Section 2 vocabulary review1

Section 2 Vocabulary Review

  • Transcription—process in nucleus where a copy of RNA is made from DNA

  • Codon—group of 3 nitrogenous bases in mRNA that code for a specific amino acid

  • Translation- The process of converting the info in an mRNA sequence into amino acids in protein chain in a ribosome.


Review objective 1

Review: Objective 1

  • Relate the concept of the gene to the sequence of nucleotides in DNA.

Genes are small nucleotide sequences

that make up our DNA


Review objective 2

Review: Objective 2

  • Sequence the steps involved in the first part of protein synthesis, called transcription.

    1. DNA uncoils and __________ up.

    2. RNA nucleotides make complementary ________ pairs with ______ strand of DNA.

    3. Before the resulting _______________ RNA strand leaves the ______________, introns are ________ out and the _________ are pasted back together

opens

one

base

messenger

nucleus

cut

exons


Review objective 3

Review: Objective 3

  • Sequence the steps involved in the second part of protein synthesis, called “translation”.

  • 1. mRNA ________ the nucleus and moves to a _________.

  • 2. ______ enters the ribosome, bringing various _______ _______ along.

  • 3. Amino acids are joined to each other by ________ bonds.

  • 4. ______ is released to go pick up another _______ _____.

  • 5. The final protein chain is sent to the _______ for transport to other parts of the cell.

leaves

ribosome

tRNA

amino

acids

peptide

tRNA

amino acid

ER


  • Login