METABOLISMO DE ÁCIDOS NUCLEICOS
This presentation is the property of its rightful owner.
Sponsored Links
1 / 40

METABOLISMO DE ÁCIDOS NUCLEICOS PowerPoint PPT Presentation


  • 96 Views
  • Uploaded on
  • Presentation posted in: General

METABOLISMO DE ÁCIDOS NUCLEICOS. GEN : es la UNIDAD DE INFORMACIÓN, es el segmento de ADN que codifica la información necesaria para producir un producto biológico funcional, como péptido, proteína o ARN.

Download Presentation

METABOLISMO DE ÁCIDOS NUCLEICOS

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Metabolismo de cidos nucleicos

METABOLISMO DE ÁCIDOS NUCLEICOS


Metabolismo de cidos nucleicos

GEN: es la UNIDAD DE INFORMACIÓN, es el segmento de ADN que codifica la información necesaria para producir un producto biológico funcional, como péptido, proteína o ARN.

ATGCCAGGCCCCCCACCAGCCACGTTGGGGCAGCCCCCACAGCTCCCGGCCTTCGGGCCAAGGTGTCGGGGTGCGTCTCCTGGCCCATCAATACAGATTACATATTTATATCAATCGCGGGCTCTGAGGGCGCCCTCGGAGAGCGGCCCCGCGCCTACGAAACCAAACTGGGAGTGGTCGCGCGGAAACTCTGGCTCGGGATTGGCTGCGGGCGCCCGCCGCGGTGCGGGGGGATTGCTAATCGTATTCAGCATGTTTTGCACAAGAAATGTCAGCCAGAAAGGGCTATCTGCTCCCTTCGCCAAATTATCCCACAACAATGTCATGCTCGGAGAGCCCCGCCGCGAACTCTTTTTTGGTCGACTCGCTCATCAGCTCGGGCAGAGGCGAGGCAGGCGGCGGTGGTGGTGGCGCGGGGGGCGGCGGCGGTGGCGGTTACTACGCCCACGGCGGGGTCTACCTGCCGCCCGCCGCCGACCTGCCATACGGGCTGCAGAGCTGCGGGCTCTTCCCCACGCTGGGCGGCAAGCGCAATGAGGCAGCGTCGCCGGGCAGCGGTGGCGGTGGCGGGGGTCTAGGTCCCGGGGCGCACGGCTACGGGCCCTCGCCCATAGACCTGTGGCTAGACGCGCCCCGGTCTTGCCGGATGGAGCCGCCTGACGGGCCGCCGCCGCCGCCCCAGCAGCAGCCGCCGCCCCCGCCGCAACCACCCCAGCCAGCGCCGCAGGCCACCTCGTGCTCTTTCGCGCAGAACATCAAAGAAGAGAGCTCCTACTGCCTCTACGACTCGGCGGACAAATGCCCCAAAGTCTCGGCCACCGCCGCCGAACTGGCTCCCTTCCCGCGGGGCCCGCCGCCCGACGGCTGCGCCCTGGGCACCTCCAGCGGGGTGCCAGTGCCTGGCTACTTCCGCCTTTCTCAGGCCTACGGCACCGCCAAGGGCTATGGCAGCGGCGGCGGCGGCGCGCAGCAACTCGGGGCTGGCCCGTTCCCCGCGCAGCCCCCGGGGCGCGGTTTCGATCTCCCGCCCGCGCTAGCCTCCGGCTCGGCCGATGCGGCCCGGAAGGAGCGAGCCCTCGATTCGCCGCCGCCCCCCACGCTGGCTTGCGGCAGCGGCGGGGGCTCGCAGGGCGACGAGGAGGCGCACGCGTCGTCCTCGGCCGCGGAGGAGCTCTCCCCGGCCCCTTCCGAGAGCAGCAAAGCCTCGCCGGAGAAGGATTCCCTGGGTAAGCAGGGCTGCAGAGGGCTGCAGTCAGGCGGGCAGACAGGCAGACACAAGGAGGAGAAGGATCAGAAAACTAGGAGCCCGCGCAGCAGCCGGCCGGCCTTGGCCCAAGCTGCAGGCAGGCTGACCTTGTGAACTTGCTTTTTAATATTTGGGCGTGGGGGCGCAGTAAAATTCATGTCCGGCTTAGCGCCCCACAGCAAGACGTCCTCGGCGCTGGCCTCAGCTCCCCCTGACTAGGGACGAGGACACCAGCGAGCAGGCCCCCTCCTGTGCGCTCTTTCCTGTGGCCGGGAGGACCCAGAGCCCTGGTCCCTGCCCAGCCTGCGCGGCGCGGCCCACGCGGGGGGAGGGGGAGGGAGGGAAAGTAGCTCGCCCGCAGATAGCGCGGATGTTTGTAAGGCATCCAAAATAAGCAGCCGCCAGCGCCAATAAATAAGCCCATTAACCGGCGAAGTTCGAGTGTACGATCCCCCATGCTTTTTTCAAAGTTGCTGAGGGGCGGGAATCTTCGTGGCGGGAAGAAGAAAAGGCAAATCCGGCCTGGAAGCGGGGGGCCCTGAGCTGAGAGCCAGAGAAGGGCCATTTCCCTTCCCCTGGACCTCGGAATCGCCCAGCTATGTATCCTGGCTCCTGGAGAAACTTGAGGGAGGGCCCTTGACCCCCGAATCGGTTTTTCCTGCCTTCCCCATTGGACCAATGATGCCCTTCTTTCTCCCCTTATCGAGTCTTGGGCAATCAGGGCCCTGGGGTGAGACAGCCAAGCTGCCTGGCCCATCTTCCAAGTAAGCACCCCGCGCTCCTAGCCTGGGGGCTACAGGAAATGCTTGTCTGCCATATGGCAAGAGGCAAAGAAAAGCGTTAAGTTCAAGATGTACAGCCTGCCCTCCCAGGCTCACAGCCAACTTTAATTTTTCCTGATGAATCTCCAGGCGAC

Individuo

GEN

Genoma

Cromosomas


Metabolismo de cidos nucleicos

Replicación

ADN

Transcripción

DOGMA CENTRAL

DE LA GENETICA

ARN

Traducción

Péptido o proteína


Metabolismo de cidos nucleicos

CODÓN

  • El concepto: UN GEN-UNA CADENA POLIPEPTÍDICA se fue actualizando

  • Hoy se conoce que no todos los genes se expresan finalmente como proteínas

  • Algunos codifican diferentes clases de ARN (como rARN y tARN) GENES ESTRUCTURALES

  • Otros poseen función reguladora  GENES REGULADORES

  • Estos últimos contienen señales que permiten identificar el comienzo y el final de los genes estructurales

  • O bien participan tanto en la activación como en la desactivación de la transcripción de genes estructurales.

  • La mayoría de los genes se encuentran formando parte de los cromosomas nucleares.

  • Las mitocondrias y los cloroplastos también poseen pequeñas cantidades de ADN y genes, que codifican para tARN y rARN mitocondriales y para un pequeño número de proteínas mitocondriales y cloroplásticas.


Metabolismo de cidos nucleicos

Niveles de Organización del ADN


Disposici n del adn en los cromosomas

Fragmento de ADN

en doble hélice

Cromatina enrrollada

sobre histonas

Cromatina

empaquetada

en nucleosomas

Fragmento de cromosoma extendido

Fragmento de cromosoma condensado

Cromosoma

Gen

Cada molécula de ADN se encuentra empaquetada en los cromosomas en una longitud 10.000 veces menor.

Disposición del ADN en los cromosomas


Cidos nucleicos estructura molecular del adn

Acido desoxirribonucleico (ADN)

1953. Watson, Crick y Wilkins

Representación esquemática de la estructura helicoidal del ADN

Esqueleto

Azúcar-Fosfato

Esqueleto

Azúcar-Fosfato

Pares de Bases

F

F

F

F

F

F

F

F

F

F

- a-hélice con giro a la derecha.

  • Cadenas complementarias y

    antiparalelas.

  • Desoxinucleótidos de A, T, G, y C.

  • G-C 50% más fuerte que A-T.

Az

Az

Az

Az

Az

OH

3’

5’

3’

5’

Az

Az

Az

Az

Az

G

G

G

C

C

C

A

A

Uniones Puente

Hidrógeno

T

T

3’

5’

Uniones Puente Hidrógeno

5’

3’

HO

Nucleótido

Ácidos Nucleicos: Estructura molecular del ADN

El Código genético esta dado por la secuencia de las bases


Metabolismo de cidos nucleicos

REPLICACIÓN


Proceso de replicaci n del adn

ADN de doble cadena original

Producto intermediario en la replicación semiconservativa

Dos moléculas de ADN de doble cadena hijas

Proceso de Replicación del ADN

CARACTERISTICAS GENERALES DE LA REPLICACION

- Semiconservadora.

- Dirección 5’→ 3’.

  • Hebras antiparalelas: rezagada y continua.

  • Se lleva a cabo en el núcleo y mitocondrias de células animales y en cloroplastos de células vegetales.

  • DNA POLIMERASAS (I,II, III)

  • La polimerización del ADN debe cumplir con dos requisitos:

  • Todas las polimerasas requieren un cadena molde de ADN

  • Según las reglas de apareamiento de bases: guanina (G) se une con citosina (C) y adenina (A) se une a timina (T).

  • Se requiere un cebador. El cebador es un segmento de secuencia complementaria a la hebra molde, de unos pocos nucleótidos y con un grupo -OH en posición 3´ al que se pueden añadir nucleótidos. Dicho extremo 3´ se denomina extremo cebador.


Metabolismo de cidos nucleicos

  • El mecanismo de replicación o síntesis de ADN sería el siguiente:

  • 1)- Para tener acceso a las cadenas de ADN que servirán de molde, éstas deben separarse, esto se consigue por medio de enzimas denominadas HELICASAS.

  • Estas enzimas se trasladan a lo largo del ADN y separan las cadenas requiriendo ATP.

  • 2)- La separación de las cadenas genera tensiones en la estructura helicoidal del ADN, que se eliminan por acción de las TOPOISOMERASAS.

  • 3)- Las cadenas separadas se estabilizan por medio de las PROTEÍNAS DE UNIÓN AL ADN.

  • 4)- Para que las polimerasas puedan actuar, deben estar presentes los CEBADORES.

  • Estos son fragmentos cortos de ARN, sintetizados por las PRIMASAS que deben estar unidas al ADN antes que las ADN polimerasas comiencen la síntesis.

  • 5)- Los cebadores, son eliminados al término de la replicación por la ADN polimerasa I y reemplazados por ADN (dNTP). Después que esto sucede, quedan puntos donde el enlace fosfodiéster no se ha constituido.

  • Estos cortes son sellados por enzimas llamadas ADN LIGASAS.


Metabolismo de cidos nucleicos

ADN Polimerasa

Cadena adelantada

Topoisomerasa

Helicasa

Cebador

Fragmentos de Okazaki

proteínas de unión al ADN

ADN Polimerasa

Sistema ADN replicasa o Replisoma

  • Cada una de las hebras del ADN bicatenario sirve de molde para la síntesis de una cadena nueva

  • Por lo tanto, las moléculas nuevas de ADN estarán constituidas por una cadena nueva y una vieja

  • De allí que este proceso se defina como REPLICACIÓN SEMICONSERVADORA

Complejo de reconocimiento del origen (ORC)


Metabolismo de cidos nucleicos

1-Iniciación. Desenrrollamiento de la doble hélice por acción de la HELICASA, separación de las hebras y síntesis de la nueva cadena conductora en dirección 5’---3’, por la POLIMERASA III .

3-Elongación. Síntesis de la cadena retardada corta (fragmento de Okazaki) por acción de la Polimerasa III a partir del ARN cebador.

4-Elongación. Eliminación del ARN cebador por la POLIMERASA I y unión del fragmento de Okazaki al ADN de la cadena retardada sintetizada previamente mediante la ADN LIGASA.

2-Iniciación. Síntesis del ARN cebador por la PRIMASA.

3’

  • 5-Elongación. La continuación de la síntesis de la hebra conductora, expone otra zona de cadena única en la mólecula original para la síntesis de un nuevo fragmento de Okazaki de la hebra retardada, repitiéndose el proceso hasta la replicación de toda la molécula de ADN original.

5’

5’

3’

5’

3’

3’

5’

3’

5’

5’

3’

5’

3’

ARN cebador

3’

5’

5’

3’

3’

Fragmento de Okazaki

3’

5’

5’

3’

3’

5’

3’

5’

5’

5’

Fragmento de Okazaki

3’

3’

5’

Representación esquemática de la replicación del ADN

6-Terminación. la horquilla de replicación se encuentra en una determinada región con múltiples copias de una secuencia de bases llamadas Ter (por terminal). Allí la horquilla de replicación se detiene y culmina la replicación.


Metabolismo de cidos nucleicos

  • Reparación del ADN

  • Una célula generalmente posee una, o a lo sumo dos, copias de ADN genómico.

  • Mientras que las proteínas y el ARN son reemplazados rápidamente si son dañados, (usando la información contenida en el ADN), éste es prácticamente irreemplazable.

  • El mantenimiento de la información contenida en el ADN es vital y requiere que cada célula mantenga un complicado sistema de reparación.

  • El ADN puede ser dañado por diversos agentes ambientales o por procesos espontáneos.

  • Una lesión no reparada del ADN, puede transmitirse a generaciones futuras y se denomina, en general, mutación.

  • La presencia de defectos en genes que codifican las enzimas de reparación del ADN tienen graves efectos.


Metabolismo de cidos nucleicos

  • Una célula típica de mamífero suele acumular varios miles de lesiones a lo largo de cada día, pero gracias a los mecanismos de reparación, menos de 1 lesión sobre cada 1000, se transforma en una mutación.

  • La cantidad y diversidad de los sistemas de reparación del ADN refleja la importancia del proceso para asegurar la supervivencia de las células.

  • La reparación del ADN es posible en gran parte a que está constituido por dos cadenas complementarias y, por lo tanto, siguiendo las instrucciones del molde en la cadena complementaria no dañada, es posible reparar de manera precisa la lesión del ADN en la otra cadena.

  • Como detalle importante cabe señalar que la reparación del ADN es energéticamente muy costosa.


Metabolismo de cidos nucleicos

  • El primer agente de control de calidad es la ADN polimerasa d.

  • Hay otras polimerasasgyeque tiene actividad exonucleasa (3’- 5’), que les permite eliminar la última base incorporada si no esta correctamente apareada.

  • Agentes que producen lesiones  agentes físicos y químicos  luz UV: forma enlaces covalentes entre T, bloqueando la replicación. (Radicales libres, radiación)

  • Mecanismos de reparación: a) errores de apareamiento, b) escisión de base, c) escisión de nucleótidos, d) ruptura de las 2 cadenas.

  • Participan:

  • - endo y exonucleasas.

    • incorporación de las bases o nucleótidos correctos

    • unión de los trozos nuevos por la ligasa.


Fases del ciclo celular en c lulas eucariotas

Fases del Ciclo Celular en células eucariotas

Proteínas:

p53

p21


Metabolismo de cidos nucleicos

  • Acido Ribonucleico (ARN)

  • La transferencia de la información genética exige la síntesis de una molécula de ácido ribonucleico (ARN), transcripta a partir de un molde de ADN, por una ARN polimerasa.

  • A primera vista, parece ser una molécula similar, pero presenta algunas características que la distinguen del ADN:

  • 1) un –OH en el C2 de ribosa,

  • 2) sustitución de timina por uracilo,

  • 3) la molécula está constituida por una única hebra y

  • 4) éstas moléculas se pliegan sobre sí mismas dando lugar a una diversidad estructural más amplia que la observada para el ADN.

  • El ARN es la única molécula conocida que tiene funciones tanto informativas como catalíticas.

  • Con la excepción de ciertos ARN virales, todas las moléculas de ARN se forman a partir de información almacenada en el ADN.

  • En un proceso denominado TRANSCRIPCIÓN, la información contenida en un segmento del ADN de doble cadena pasa a una cadena de ARN con una secuencia de bases complementarias a las de la hebra del ADN.


Metabolismo de cidos nucleicos

  • Una molécula de ARN recién sintetizada se denomina TRANSCRIPTO PRIMARIO.

  • Un transcripto primario de ARNm contiene la secuencia presente en un gen.

  • En ella hay fragmentos codificantes (EXONES) y no codificantes (INTRONES).

  • Existen tres clases principales de ARN:

  • -el ARN MENSAJERO (ARNm), codifica la secuencia de aminoácidos de uno o más polipéptidos especificados por un gen o por un conjunto de genes. (ARN polimerasa II)

  • -el ARN DE TRANSFERENCIA (tARN), que actúa como un adaptador, lee la información contenida en el ARNm y transfiere el aminoácido adecuado a la cadena polipeptídica en formación durante la síntesis proteica. (ARN polimerasa III)

  • -el ARN RIBOSÓMICO (rARN) está asociado con proteínas formando el ribosoma. (ARN polimerasa I)

  • Existen además otros ARN especializados que poseen funciones reguladoras o catalíticas.


Metabolismo de cidos nucleicos

TRANSCRIPCIÓN

-Es similar a la replicación del ADN desde el punto de vista químico, por la polaridad y el empleo de una hebra molde.

-También presenta fases de iniciación, elongación y terminación.

-Las diferencias residen en que la transcripción no requiere de cebador, afecta sólo a cortos segmentos de una molécula de ADN y sólo una de las cadenas sirve de molde.

Splicing espliciosoma


Metabolismo de cidos nucleicos

  • Factores de transcripción:

  • Se unen al ADN y a la ARN polimerasa

  • Ubican a la polimerasa en la posición correcta en el promotor

  • Colaboran en la separación de las 2 hebras

  • Promueven la iniciación de la transcripción.


Metabolismo de cidos nucleicos

Secuencia de inicio: Promotor


Metabolismo de cidos nucleicos

7-metil-guanosina


Transcripci n y traducci n de un gen eucariota

5'UTR

3'UTR

Exon 1

Exon 2

Exon 3

Intron 1

Intron 2

preARNm:

AUG

UAA

5´ CAP

polyA

UAA

AAAAAAAAA

ARNm:

AUG

Traducción

proteína

MPLTW

..............GFL

MPLTW

..............PJC

Modificaciones post-traduccionales

MPLTW

..............LAC

Transcripción y traducción de un gen eucariota

Corte y empalme

Poliadenilación


Traducci n s ntesis de prote nas componentes

TRADUCCIÓNSíntesis de ProteínasComponentes

  • mRNA

  • tRNA

  • Ribosomas

  • Chaperonas

  • Enzimas

  • Factores de regulación

  • Hidrólisis de ATP o GTP


C digo gen tico

codón

AUGCAGUGGAAACUAUAG

ARNm

Met- Gln–Trp--

Código genético

  • Universal: es idéntico para las

    distintas especies animales y vegetales

  • Degenerado: más de un codón

    codifica para el mismo aminoácido.

Lys

Leu

stop

20 aac.  4 bases  combinadas en codones o tripletes  43 = 64

Sobran 44 codones  iniciación, elongación, stop


Tipos de arn y caracter sticas espec ficas

Tipos de ARN y características específicas


Tipos de arn ribosomal transferencial y mensajero

Tipos de ARN: ribosomal, transferencial y mensajero


S ntesis de prote nas

Síntesis de Proteínas

  • Traducción

    • Tres partes

      • Iniciación

        • Unidad menor del ribosoma

        • tRNA inicial

        • Codón Inicial

      • Extensión

        • Incorporan los amino ácidos.

        • Enlace peptídico

      • Terminación

        • Culmina el proceso de traducción.


Metabolismo de cidos nucleicos

2

2

1

P

A

3’

Dirección de lectura del mARN

Gli

Ala

Codón

5’

mARN

Val

Ribosoma

Codones para los correspondientes aminoácidos

Aminoácidos libres

Cadena polipeptídica en formación

tARN transportando un Aminoácido

tARN

Enzima Peptidililtransferasa

1

Met

Fen

Leu

Gli

EF-G o Translocasa

Val

Val

Ala

Anticodón

tARN

Representación esquemática de la síntesis proteica


  • Login