slide1
Download
Skip this Video
Download Presentation
INVERSIONES : VARIACIÓN ESTRUCTURAL EN LA QUE UN SEGMENTO

Loading in 2 Seconds...

play fullscreen
1 / 29

INVERSIONES : VARIACIÓN ESTRUCTURAL EN LA QUE UN SEGMENTO - PowerPoint PPT Presentation


  • 100 Views
  • Uploaded on

A B C D E F G. A B C E D F G. INVERSIONES : VARIACIÓN ESTRUCTURAL EN LA QUE UN SEGMENTO CAMBIA DE SENTIDO DENTRO DEL PROPIO CROMOSOMA (Y POR TANTO LA ORDENACIÓN DE SUS LOCI ).

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' INVERSIONES : VARIACIÓN ESTRUCTURAL EN LA QUE UN SEGMENTO' - perry


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1

A B C D E F G

A B C E D F G

INVERSIONES:

VARIACIÓN ESTRUCTURAL EN LA QUE UN SEGMENTO

CAMBIA DE SENTIDO DENTRO DEL PROPIO CROMOSOMA

(Y POR TANTO LA ORDENACIÓN DE SUS LOCI).

Sturtevant, 1926

Dos roturas en el ADN y un giro de 180º en sentido perpendicular

slide2

A B C E D F G

5’ ACGTTACCCGTGTGTGAAGAACTACGTACAGCATGC 3’

3’ TGCAATGGGCACACACTTCTTGATGCATGTCGTACG 5’

5’ ACGTTACCCGTGTGTGTACGTAGTTCTTCAGCATGC 3’

3’ TGCAATGGGCACACACATGCATCAAGAAGTCGTACG 5’

A B C D E F G

Son necesarias dos roturas en el ADN y

un giro de 180º en sentido perpendicular

slide3

S S

S M

M M

-COMPORTAMIENTO CITOLÓGICO:

-PROBLEMAS EN LÍNEA GERMINAL:

EL PASO POR LA R! (No presentan problemas en mitosis pero las inversiones pericéntricas pueden cambiar la morfología de los cromosomas)

PERO TODO DEPENDE DEL TIPO DE INVERSIÓN…

slide4

TIPOS DE INVERSIONES:

-Simples(un solo segmento invertido)

paracéntricas (el segmento invertido no incluye el centrómero)

pericéntricas (el segmento invertido incluye el centrómero)

-Complejas(se invierten simultáneamente varios segmentos de un

mismo cromosoma)

independientes: A`BC´DE`FG´H→ACBDEGFH

en tándem: A`BCD´`EF´GH→ADCBFEGH

incluidas: A`BCDEFG´H→AGF`EDC´BH→AGFCDEBH

solapantes: A`BCD´EFGH→AD`CBEF´GH→ADFEBCGH

slide6

Homozigoto

Heterozigoto

slide13

INVERSIÓN PARACÉNTRICA: DOS SOBRECRUZAMIENTOS

UNO INTERIOR Y OTRO EXTERIOR A LA INVERSIÓN:

slide18

INVERSIÓN PERICÉNTRICA: DOS SOBRECRUZAMIENTOS

UNO INTERIOR Y OTRO EXTERIOR A LA INVERSIÓN:

slide19

-EL PASO POR MEIOSIS DE LA INVERSIÓN:

Depende de:

1 - tipo de inversión (para- o pericéntricas)

2 - tamaño de la inversión (las pequeñas no afectan)

3 - posición del sobrecruzamiento (dentro o fuera del bucle;

complementarios o recíprocos…)

4 - número de sobrecruzamientos

slide20

INVERSIONES Y EVOLUCIÓN: mecanismo

-Inversiones: supresoras de la recombinación:

-Impedimentos estructurales: no aparean (salvo bucle)

-Si aparean y recombinan (1) en el bucle obtenemos el gameto normal y el invertido (...)

SUPERGENES:

“Un grupo de de genes ligados que son (o tienden a ser) transmitidos como una unidad hereditaria, y que por tanto se mantienen juntos sobre un cromosoma”

Darlington y Mather, 1949

slide21

INVERSIONES Y EVOLUCIÓN: Consecuencias y usos

-Generación de letales equilibrados

Las inversiones son un mecanismo para silenciar alelos letales

Pero la generación de letales equilibrados mediante inversiones

contribuye a su supervivencia

-Control de plagas

-Establecimiento de filogenias mediante estudios de inversiones

DOBZHANSKY. GENETICS 23: 28 Jan. 1938

slide22

CROMOSOMA 3 DE Drosophila pseudoobscura y D. persimilis

Costa Oeste de América de Alaska a Guatemala; distribución discontinua

Cruces: descendencia homocigota estructural: salvajes

descendencia heterocigota estructural: presencia de mutación

Tendencia a mostrar inversiones paracéntricas: producen gametos viables

normales e invertidos, beneficioso para la especie cuando los genes incluidos

en la zona de la inversión se han coadaptado en una combinación óptima:

supergenes

slide24

MAYOR VALOR ADAPTATIVO DE LOS HETEROCIGOTOS

ESTRUCTURALES PARA LA INVERSIÓN

(Dobzhansky y Levene, 1948)

-Hembras inseminadas de una población natural: descendencia

en equilibrio Hardy-Weinberg en laboratorio.

-Machos adultos de la misma población: cruzándolos con hembras

de genotipo conocido, la frecuencia de machos capturados

mostraba mayor proporción de heterocigotos.

En la población natural, mayor número de heterocigotos

Estructurales: mayor valor adaptativo.

slide25

S S

S M

M M

SISTEMA EVOLUTIVO DE LAS INVERSIONES

-Supresión de la recombinación (en los supergenes)

-Aumento de la frecuencia de heterocigotos estructurales:

normal-invertido

-Generación de homocigotos estructurales

Y empezaran a recombinar entre sí los individuos homocigotos...

slide27

3

Formación de los homozigóticos

x

x

slide28

x

Segunda etapa evolutiva

ad