A          B          C           D           E          F          G
Download
1 / 29

INVERSIONES : VARIACIÓN ESTRUCTURAL EN LA QUE UN SEGMENTO - PowerPoint PPT Presentation


  • 100 Views
  • Uploaded on

A B C D E F G. A B C E D F G. INVERSIONES : VARIACIÓN ESTRUCTURAL EN LA QUE UN SEGMENTO CAMBIA DE SENTIDO DENTRO DEL PROPIO CROMOSOMA (Y POR TANTO LA ORDENACIÓN DE SUS LOCI ).

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' INVERSIONES : VARIACIÓN ESTRUCTURAL EN LA QUE UN SEGMENTO' - perry


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

A B C D E F G

A B C E D F G

INVERSIONES:

VARIACIÓN ESTRUCTURAL EN LA QUE UN SEGMENTO

CAMBIA DE SENTIDO DENTRO DEL PROPIO CROMOSOMA

(Y POR TANTO LA ORDENACIÓN DE SUS LOCI).

Sturtevant, 1926

Dos roturas en el ADN y un giro de 180º en sentido perpendicular


A B C GE D F G

5’ ACGTTACCCGTGTGTGAAGAACTACGTACAGCATGC 3’

3’ TGCAATGGGCACACACTTCTTGATGCATGTCGTACG 5’

5’ ACGTTACCCGTGTGTGTACGTAGTTCTTCAGCATGC 3’

3’ TGCAATGGGCACACACATGCATCAAGAAGTCGTACG 5’

A B C D E F G

Son necesarias dos roturas en el ADN y

un giro de 180º en sentido perpendicular


S S G

S M

M M

-COMPORTAMIENTO CITOLÓGICO:

-PROBLEMAS EN LÍNEA GERMINAL:

EL PASO POR LA R! (No presentan problemas en mitosis pero las inversiones pericéntricas pueden cambiar la morfología de los cromosomas)

PERO TODO DEPENDE DEL TIPO DE INVERSIÓN…


TIPOS DE INVERSIONES: G

-Simples(un solo segmento invertido)

paracéntricas (el segmento invertido no incluye el centrómero)

pericéntricas (el segmento invertido incluye el centrómero)

-Complejas(se invierten simultáneamente varios segmentos de un

mismo cromosoma)

independientes: A`BC´DE`FG´H→ACBDEGFH

en tándem: A`BCD´`EF´GH→ADCBFEGH

incluidas: A`BCDEFG´H→AGF`EDC´BH→AGFCDEBH

solapantes: A`BCD´EFGH→AD`CBEF´GH→ADFEBCGH


Homozigoto G

Heterozigoto






INVERSIÓN PARACÉNTRICA: DOS SOBRECRUZAMIENTOS G

UNO INTERIOR Y OTRO EXTERIOR A LA INVERSIÓN:






INVERSIÓN PERICÉNTRICA: DOS SOBRECRUZAMIENTOS G

UNO INTERIOR Y OTRO EXTERIOR A LA INVERSIÓN:


- GEL PASO POR MEIOSIS DE LA INVERSIÓN:

Depende de:

1 - tipo de inversión (para- o pericéntricas)

2 - tamaño de la inversión (las pequeñas no afectan)

3 - posición del sobrecruzamiento (dentro o fuera del bucle;

complementarios o recíprocos…)

4 - número de sobrecruzamientos


INVERSIONES Y EVOLUCIÓN: mecanismo G

-Inversiones: supresoras de la recombinación:

-Impedimentos estructurales: no aparean (salvo bucle)

-Si aparean y recombinan (1) en el bucle obtenemos el gameto normal y el invertido (...)

SUPERGENES:

“Un grupo de de genes ligados que son (o tienden a ser) transmitidos como una unidad hereditaria, y que por tanto se mantienen juntos sobre un cromosoma”

Darlington y Mather, 1949


INVERSIONES Y EVOLUCIÓN: Consecuencias y usos G

-Generación de letales equilibrados

Las inversiones son un mecanismo para silenciar alelos letales

Pero la generación de letales equilibrados mediante inversiones

contribuye a su supervivencia

-Control de plagas

-Establecimiento de filogenias mediante estudios de inversiones

DOBZHANSKY. GENETICS 23: 28 Jan. 1938


CROMOSOMA 3 DE GDrosophila pseudoobscura y D. persimilis

Costa Oeste de América de Alaska a Guatemala; distribución discontinua

Cruces: descendencia homocigota estructural: salvajes

descendencia heterocigota estructural: presencia de mutación

Tendencia a mostrar inversiones paracéntricas: producen gametos viables

normales e invertidos, beneficioso para la especie cuando los genes incluidos

en la zona de la inversión se han coadaptado en una combinación óptima:

supergenes



MAYOR VALOR ADAPTATIVO DE LOS HETEROCIGOTOS G

ESTRUCTURALES PARA LA INVERSIÓN

(Dobzhansky y Levene, 1948)

-Hembras inseminadas de una población natural: descendencia

en equilibrio Hardy-Weinberg en laboratorio.

-Machos adultos de la misma población: cruzándolos con hembras

de genotipo conocido, la frecuencia de machos capturados

mostraba mayor proporción de heterocigotos.

En la población natural, mayor número de heterocigotos

Estructurales: mayor valor adaptativo.


S S G

S M

M M

SISTEMA EVOLUTIVO DE LAS INVERSIONES

-Supresión de la recombinación (en los supergenes)

-Aumento de la frecuencia de heterocigotos estructurales:

normal-invertido

-Generación de homocigotos estructurales

Y empezaran a recombinar entre sí los individuos homocigotos...


Evolución de las Inversiones –Supergenes- G

Primera etapa evolutiva

1

2

3


3 G

Formación de los homozigóticos

x

x


x G

Segunda etapa evolutiva



ad