Lecture 2: Biology Review II

1. Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers

2. Genetic Mapping • Definition: A genetic map is an ordering of genes and markers in a linear arrangement corresponding to their physical order along the chromosome. Based on linkage. • Definition: A physical map is an ordering of landmarks on DNA, regardless of inheritance. Measured in base pairs.

3. Marker • Definition: A marker is a gene or piece of DNA with easily identified phenotype such that cells or individuals with different alleles are distinguishable. • e.g. a gene with known function • e.g. a single nucleotide change in DNA

4. Polymorphism • Definition: A polymorphism is a detectable and heritable variation at a locus. • Definition: A marker is polymorphic if the most abundant allele comprises less than X% of all alleles, usually 95%. • Definition: A mapping population is a population used to map genes.

5. Natural Populations • Definition:Natural populations are those where mating is not controlled by the experimenter, though the experimenter can choose who to observe. • Only phenotype observable, genotype sometimes unknown, phase is unknown. • Knowns: allele frequencies, genotype frequencies, amount of disequilibrium.

6. Hardy-Weinberg Equilibrium I • Refers to the equilibrium achieved at a single locus. • Hardy-Weinberg Equilibrium (HWE) is achieved when the allele frequencies and genotype frequencies do not change from generation to generation.

7. Hardy-Weinberg Equilibrium II • Let pAand pB be the frequencies of allele A and B in the population. Let pAAbe the frequency of genotype AA. Similarly, pAB and pBB are genotype frequencies. • Then HWE implies that pAA = pA2 pAB = 2pApB pBB = pB2

8. Measures of Polymorphism P(heterozygote) = Definition: Polymorphism Information Content (PIC)

9. ½ are informative informative uninformative Uninformative Matings AB X AB 1 AA : 2 AB : 1 BB

10. Classical Linkage Analysis • A few markers. • Must have detectable variation. • Must be substantially variable in study population. • Controlled crosses: testcross, backcross, double- haploid • Well-defined parental lines.

11. Three-Point Testcross Design dominant recessive testcross X X F1 F2 A S Y A S Y b t z b t z A S Y b t z b t z b t z b t z b S z X X

12. Three-Point Testcross Results • Count the number of recombinant haplotypes produced by F1 parent. Calculate the recombinant fraction for each pair of genes.

13. Map for Three-Point Testcross 3 2 1 0.03 0.15 0.19

14. Backcross Design new recombinant self self F2 no more changes

15. Large-Scale Mapping • Many genetic markers • Steps of analysis: • pairwise linkage analysis • group into linkage groups • order markers in each linkage group

16. Comparative Mapping • Compare maps of different species. • Due to similarities, information can be transferred between species. • Information about how genomes evolve. • Uses conserved loci rather than highly variable loci.

17. Molecular Techniques: probes 5’ – …AAGCCTAGAGCCCTTAGCCAAAAG… – 3’ 3’ – …TTCGGATCTCGGGAATCGGTTTTC… – 5’ denature add probe 3’ – *ATCTCGGGAATC – 5’ hybridization 5’ – …AAGCCTAGAGCCCTTAGCCAAAAG… – 3’ *ATCTCGGGAATC

18. Molecular Techniques: restriction enzymes Definition: An endonuclease is an enzyme (protein that acts as a catalyst to speed up the rate of a biochemical reaction) that cleaves nucleic acid strands at internal sites (phosphodiester bond). Definition: A restriction endonuclease is an enzyme that cuts DNA at specific sites that it recognizes. EcoRI 5’ GAATTC 3’ 3’ CTTAAG 5’ number of cut sites = N/4b

19. Molecular Techniques: gel electrophoresis • DNA is negatively charged. Proteins can also be charged. • An electric current is passed through a porous medium (agarose, acrylamide) and molecules in the medium respond by moving in electric field, but at different rates based on size and charge.

20. Electrophoretic Gel

21. 5’ 5’ 5’ 5’ Molecular Technique: PCR I 5’ 5’ Denaturation and hybridization Elongation & denaturation

22. Molecular Technique: PCR II

23. Physical Maps • Banding patterns on chromosomes • In-situ hybridization • Denature metaphase chromosomes • Add radioactive or fluorescent probe • Visualize chromosomes • DNA fragmentation • DNA sequence: still not practical for all organisms

24. DNA Fragmentation • Larger fragments better (rare cutters; partial digestion) • Find overlap by sequencing or hybridization.

25. DNA Vector I • Definition: A cloning vector is a DNA molecule that is capable of self-replicating. Insert the fragment of foreign DNA to make recombinant DNA.

26. DNA Vector II • phage: virus that infects bacteria (5-25 kb). • cosmid: Packaged in lambda phage and infects E. coli (35-45 kb). • yeast artificial chromosome (YAC): has telemere, centromere, and replication origin (200-2000 kb). • bacterial artificial chromosome (BAC) • plasmid: extrachromosomal circular DNA nonessential for cell survival.

27. How Many Clones? Let N be the number of clones made. Let NSbe the number of nonoverlapping clones needed to cover the full genome. More: M. S. Waterman Introduction to Computational Biology: Maps, Sequences, and Genomes

28. Genetic Mapping Still Needed • Even if the full sequence is known, mapping is still necessary. • There must be some way to correlate a trait/phenotype with something on the sequence.

29. Physical Mapping Still Needed • Linkage maps lack resolution • Sample more people • Better statistics • Let recombination accumulate over many generations. • Even with most precise linkage map can identify a gene to 1 cM (1 Mb in humans).

30. Morphological Markers • Differences in shape, color, size, etc. • Must have one-to-one correspondence with a controlling gene.

31. Protein Markers • Definition: An isozyme are proteins with same enzymatic function but different structural, chemical, or immunological characteristics. • Differences: amino acid composition, size, modifications (e.g. phosphorylation). • Differences visualized: gel electrophoresis, mass spectrometry, etc.

32. DNA Marker: RFLP I • Definition: RFLP is Restriction Fragment Length Polymorphism. • DNA digested with endonuclease. • Separate fragments by electrophoresis. • Denature strands. • Transfer single-stranded DNA to durable membrane and immobilize (Southern blot). • Hybridize labeled probe to the blot. • Visualize probe.

33. DNA Marker: RFLP II • DNA polymorphisms that RFLP identifies: • mutation in the restriction site • mutation elsewhere to create restriction site • insertion/deletion of DNA • RFLP markers are codominant

34. Mini- and Micro-Satellite Markers • Definition:minisatellites or VNTR (Variable Number of Tandem Repeats) are tandem repeates of sequences 9-100 bp long. Detected by hybridization or PCR. • Definition:microsatellites or SSR (Simple Sequence Repeat) are direct tandem repeated sequences of DNA of 1-6 bp.

35. STS and EST • Definition:Sequence tagged sites (STS) is a short unique fragment of DNA. • Definition:Expressed sequence tags (EST) are subsets of STSs from cDNA clones. Represent transcribed genes (e.g. usually proteins).

36. Single-Strand Conformational Polymorphism (SSCP) • Detects changes as small as 1 nucleotide in more than 1000 bp. • Single-stranded DNA is electrophoresed on gel and migrates based on size and shape. • Visualized by Southern blot with specific fragment probe or PCR specific fragment and visualize directly.

37. Random Amplified Polymorphic DNA (RAPD) • PCR with short probes that bind randomly to sites in the genome. • Good for genomes where little sequence information is available. • Band-present is dominant. • Expected number of products = 2fN/16b

38. Amplified Fragment Length Polymorphism (AFLP) • Cut DNA with frequent- and rare-cutting endonuclease • Anneal adapters to the ends of the frequent-cutter cut sites. • Amplify off adapters with PCR. Use various specific primers to amplify subsets of total. • Visualize on denaturing polyacrylamide gel.

39. Choosing Markers • High polymorphism. • Clear interpretation. • Quick typing and easy automation. • Personal preference.