1 / 36

Cytogenetic Rearrangements Mediated by Genomic Architecture in Meiosis

22q11. Cytogenetic Rearrangements Mediated by Genomic Architecture in Meiosis. A Closer Look at 22q11.2. Most frequent microdeletion syndrome Most common recurrent balanced translocation Bisatellited marker chromosome of CES Numerous other translocations at 22q11.

owena
Download Presentation

Cytogenetic Rearrangements Mediated by Genomic Architecture in Meiosis

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. 22q11 Cytogenetic Rearrangements Mediated by Genomic Architecture in Meiosis

  2. A Closer Look at 22q11.2 • Most frequent microdeletion syndrome • Most common recurrent balanced translocation • Bisatellited marker chromosome of CES • Numerous other translocations at 22q11

  3. The 22q11.2 Deletion Syndrome (VCFS/DGS) • Estimated frequency 1/3000-4000 live births • Autosomal Dominant Disorder • Cleft or palatal anomalies (69%) • Congenital heart defect (74%) • Learning disability • Speech and language abnormalities • Psychiatric abnormalities • Immune dysfunction • Characteristic facial features

  4. Constitutionalt(11;22) • Only known, recurrent, non-Robertsonian translocation in man • Seen in several hundred families • Balanced carriers are phenotypically normal • Risk of Supernumerary der(22)t(11;22) due to chromosomal malsegregation • 47, XX or XY, +der(22) t(11;22) • Multiple malformation syndrome • Emanuel syndrome

  5. B C c106e4 c103a2 N25 c102g9 c68a1 c87f9 c2c9 c45c9 c87h3 B A C 6 7 7 f 7 c H K 8 9 P A C 3 9 3 h 2 1 B A C 2 9 3 j 1 4 B A C 4 4 4 p 2 4 B A C 5 6 2 f 1 0 B A C 4 4 5 f 2 3 B A C 2 9 1 k 7 P A C 1 9 4 m 1 1 P A C 4 1 3 m 7 * B A C 4 8 m 1 1 B A C 3 2 i 1 1 B A C 3 7 9 n 1 1 P A C 4 2 3 n 1 4 P A C 4 0 8 l 1 1 P A C 1 3 4 n 5 B A C 1 3 5 h 6 1 . 2 M b D G C R c o s m i d c o n t i g A D BAC/PAC/Cosmid Contig Cen Tel ZNF74 D22S75 CHKAD26 D22S427 D22S941 D22S788 D22S801 D22S36 HCF2 low copy repeats = LCRs

  6. N25/HIRA t(11;22) CES CES CDC45L D22S427 D22S36 D22S75 UFD1L D22S788 ZNF74 HCF2 CHKAD26 D22S936 Ki1165 D22S801 c61e11 c102d1 TBX1 C C A A A A A' A' B B D D D E F IGLL IGLL Unbalanced translocations Kurahashi et al. McQuade et al. CH98-18 259/300 (86.3%) Rauch et al. CH98-205 CH01-242 22/300 (7.3%) CH04-18 CH97-221 5/300 (1.7%) CH03-029 CH03-162 5/300 (1.7%) CH02-008 CH03-064 Patient "g" Yamagishi et al. O'Donnell et al. 9/300 (3%) 22q11 Deletion and Rearrangement Endpoints

  7. Low Copy Repeats (LCRs) in 22q11Structure and Composition • Modular Structure • Modules range in size from 10-65 kb • Modules contain previously identified markers, truncated genes and pseudogenes • Variation in the content, orientation and organization of modules between the different copies

  8. B B Genomic Organization of the LCRs in 22q11.2 A A C C D D

  9. A B C D A B C D Crossover at LCR-D A B C D A B C D LCRs and Deletion Mechanism Normal Recombination Event

  10. A B C D A B C D Crossover between A & D A B C D A B C D A D Hypothetical Duplication or Deletion Mechanism “Misalignment followed by Recombination” A case of a deletion or duplication syndrome

  11. P3 C 1 C2 C3 C4 P1 P2 Detection of Rearranged Fragments . . D22S427 ZNF74 NotI NotI 650 kb 650 kb D22S427 D22S788 ZNF74 145 kb NotI NotI NotI A B 145 kb A-B Deletion Probed with ZNF74

  12. ZNF74 444p24Sp6 37g5T3 5 5 5 4 4 4 PCR Analysis of LCRA-LCRB Junction Fragment 3 6 M 3 6 3 6 2 1 2 1 1 2 M 37g5T3 444p24Sp6 444p24Sp6 ZNF74 B Normal A B 145 kb Lane 4 37g5T3 ZNF74 Deleted Not I Site PCR Marker 650 kb Lane 5

  13. Parent of Origin Determinations Number of patients examined = 69 • Maternal Deletions 36 • Paternal Deletions 33

  14. Examining the Mechanism of Deletion • Haplotype reconstruction • 3 generation families • Markers flanking the deletion region • Genescan analysis

  15. Results of Studies to Date • 20 informative families • 19 consistent with an interchromosomal crossover event - much greater than expected for meiotic distance • 1 consistent with an intrachromosomal event • normal 22 only has 2 interchromosomal events in 15 examined - more consistent with meiotic mapping studies • no evidence for phenotypic differences related to heart or palate based on parental origin of deletion in any of the families

  16. D22S427 CHKAD26 N25 c106e4 87h3 CHKAD26 3 Mb Deletion Region in 22q11.2 FISH to Detect an Inversion D22S788 ZNF74 A B D

  17. Summary of 22q11.2 Deletions • No major parent of origin effects - deletion or phenotype • Majority are de novo 3 Mb deletions • No genotype-phenotype correlations- • phenotype is quite variable • Unusual number of interchromosomal exchanges • unequal crossing over involving segmental duplications • other meiotic studies indicate proximal crossovers are infrequent • Inversions do not predispose to the deletion or the phenotype in absence of a deletion

  18. Isolation and analysis of the Recurrent t(11;22)(q23;q11), t(17;22) and t(A;22)

  19. LCR-B on 22q and the Constitutional t(11;22) t(11;22) centromere telomere A B C D N N (AT)n ZNF74v (AT)n (AT)n N41 duplication modules b444p24 90 kb gap b562f10 cHK89

  20. T A A T A A T G C T A T A T A T C G G C A T T T A A T A A T C G T A T G C A T C T A T A T T A C G G C G G A T T A A A T A T C T C A G T A A G C T A T T T A T A T A C G C G A G T T A T T A G C A A T G C T T A A T T G C A C G A A T T C C G G A A T T A A T G G C C A T A T A T T G C A Inverted Repeats (palindrome) A T A T A T G C A T C G A T A T A T C G C G G A C T T A A G C T A T T T A A A A T A T T T A T G C C G A T C G T A A T T A T A C T T G T C T G A T T A T G T C C T G C T G T T T C T A C A T T T T G G G C G C A T A T A T A A A A A A G G A T A C T C A G C A G A T G A C A A A C T A G C A A T A A T A T T T A A T A A T T A T A T A T G C G C A A T T C G C G PATTR at 11q23 and Stem Loop Cruciform Structures

  21. Human Genome Human Genome Translocation Bacteria Bacteria Unclonable Deletion Genomic Instability Mediates the t(11;22) Chromosome 11 Chromosome 22

  22. Analysis of the t(11;22) Breakpoint (BP) • > 42 independent BPs have been examined - PATRRs at 11q23 and 22q11 BPs • Breakpoints in all families are almost identical with very limited variation • Families are of various ethnic and racial backgrounds • i.e., implicates a similar mechanism rather than a founder effect • BPs occur at the tip of the palindrome with small, symmetrical deletions • suggests that there is likely a palindrome mediated mechanism responsible for the recurrent nature of the translocation

  23. 195 bp PATRR proximal CTAGTTATTTGCACAGTCTCCTTCAAGGCATAATTATATA--------TATATATATATA 52 distal CTAGTTATTTGCACAGTCTCCTTCAAGGCATAATTATATACATATATATATATATATATA 60 **************************************** ************ proximalTATGTATATAATTATATAGGATTATATGTAGGATTATATTTA94 distalTATGTATATAATTATATAGGATTATATGTAGGATTATATTA- 101 **************************************** Analysis of t(17;22)s in the NF1 Gene exon 31 exon 32 centromere telomere 209 bp

  24. Unexpectedly High Rate of t(11;22)s in Sperm from Normal Males • PCR performed on sperm samples from four normal males was positive for the t(11;22) PCR product • The estimated frequencies are : 1.24 - 9.46x10-5 • Testicular DNA: positive • Twenty normal lymphoblast or fibroblast DNAs: negative • Lymphoblasts from patients with Bloom syndrome or ataxia-telangiectasia:negative • PCR for t(17;22) in same sperm samples: negative • Polymorphism of the PATRR affects translocation frequency

  25. Polymorphisms of the 11q PATRR Translocation Frequency Allele type Number Frequency(%) Structure 1.07-2.27 x 10-5 Long (L) 343 87.1 1.20-2.93 x 10-6 Short (S) S1 20 (40.0) 1.55-1.71 x 10-6 S2 5 (10.0) S3 24 (48.0) <3.05 x 10-7 S4 1 (2.0) 6.81 x 10-7 Subtotal 50 12.7 <1.69 x 10-7 Extra-long (EL) 1 0.3 Total 394 100 Deletion/insertion type polymorphisms have been identified Kato et al., Science 311:971 2006

  26. Does the 11q23 PATRR Adopt a Cruciform Configuration?Atomic Force Microscopy

  27. Other Translocations to 22q11.2 • Numerous translocations have been described • None of the others are recurrent translocations • Question: Are they located in LCR-B? • Analysis to the sequence level to determine • Is a PATRR a consistent finding at the BP? • Do the different partner chromosomes share sequence homology • with one another • with 22q? • Do they demonstrate any similarities to one another with respect to location or organization of the BPs

  28. Stem Loop Structures of LCR-B and its Partners BP Region 22q11.2 LCR-B (594 bp) 100 200 500 400 BP Region 11q23 (445 bp) 100 400 300 80 40 17q11 (205 bp) 120 200 160 300 4q35.1 (1072 bp) 100 200 1000 900 600 800

  29. 400 200 300 500 100 0/1200 600 1100 700 800 1000 900 Stem Loop Structure of t(1;22) BP Deduced 1p21.2 AT-rich Breakpoint Sequence [t(1;22) patient] Reference 1p21.2 Sequence (RP4-600M23) 300 200 100 400 600 500 0/1200 700 900 1100 800 1000

  30. t(2;22) t(10;22) t(15;22) 2q14 22q11.2 10q26 22q11.2 22q12.1 15q26 t(21;22) t(X;2) t(X;4) 4q35.2 Xp21.1 21p12 22q11.2 2q37.2 Xp21.1 Non-LCR-B Translocations No Palindromic Sequences - No Stem Loops

  31. Analysis of Recombination and Proximity in Meiosis LEGEND Blue = CREST Red=SCP3 Green=MLH1 Fuschia = c87f9 Gold - 442e11

  32. 1800 1600 1400 1200 1000 Distance 800 600 400 200 0 1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 41 43 45 47 49 Comparison Between Oocytes and Spermatocytes 11q-22q 11q-22q 6q-22q 6q-22q spermatocytes oocytes Oocyte or Spermatocyte #

  33. Are the Breakpoints at Recombination “Hot-Spots?”

  34. Summary • The “genomic instability” of 22q11.2 is presumed to be based on the presence of multiple LCRs or segmental duplications • Recurrent 22q11.2 deletion endpoints coincide with the low copy repeats (LCRs) on chromosome 22 • Inversions are not a common feature that predisposes to the deletion • Interchromosomal recombination occurs in most de novo deletions - not the favored location for recombination events

  35. Summary Continued • LCR-B is the location of the t(11;22) breakpoint as well as many other translocations involving 22q11, but not all of them • A palindrome mediated mechanism is responsible for the translocations occurring in LCR-B • Other 22q11 translocations appear to be more random • LCR-B translocation BPs exhibit a propensity to form secondary structure apparently related to their rate of recurrence and perhaps polymorphisms • Constitutional translocations seem to occur between sequences of similar melting temperature and/or secondary structure.

  36. Acknowledgements Anthony Gotter Sulagna Saitta Tamim Shaikh Hiroki Kurahashi Stacy Harris April Hacker Jill Yersak Mandy Book Danielle Conforto Outside Institutions Local Debbie Driscoll Elaine Zackai Donna McDonald-McGinn Mellissa Tonneson Livija Celle Jason Catanzaro Jeanne Manson Marcia Budarf MaimonCohen Terry Ashley Ann Gaeth Harker Rhodes Tatsushi Toda Takema Kato

More Related