Evoluce gen
Download
1 / 32

Evoluce genů - PowerPoint PPT Presentation


  • 132 Views
  • Uploaded on

Evoluce genů. Obsah. materielní substrát genů vnitřní periodicita genů původ exonů a intronů. Obsah. materielní substrát genů vnitřní periodicita genů původ exonů a intronů. Každý gen vzniká z genu. genealogické vztahy mezi geny

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Evoluce genů' - ouida


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

Obsah
Obsah

  • materielní substrát genů

  • vnitřní periodicita genů

  • původ exonů a intronů


Obsah1
Obsah

  • materielní substrát genů

  • vnitřní periodicita genů

  • původ exonů a intronů


Ka d gen vznik z genu
Každý gen vzniká z genu

  • genealogické vztahy mezi geny

  • genové rodiny a nadrodiny – eukaryota asi 750 rodin (650-10000), každá v průměru 50 členů, 90 % velmi vzácných

  • motivy a moduly


Mechanismy vzniku nov ch gen
Mechanismy vzniku nových genů

  • vznik z nekódující sekvence, vzácné u vyšších 1-5 za mil. let u savců, 5-10 za mil. let u drozofil, ale stovky u kvasinky, některé Ns/Nn > 1

  • postupná transformace a změna (nebo obohacení) funkce

  • genové fúze

  • otevírání nových čtecích rámců

  • mezidruhový přenos (transformace, hybridizace, syngenese)

  • Přenos organelové DNA (promiskuitní DNA)

  • genová duplikace (vymizení 3-7 mil. let, změna funkce)

  • Celogenomová duplikace, WGD (obratlovci 2x)

  • vznik z nadbytečné kopie u diploidů


Vznik novéhu genu u diploida

mutace

genová duplikace

crossing over


Mechanismy vzniku nov ch gen1
Mechanismy vzniku nových genů

  • postupná transformace a změna (nebo obohacení) funkce

  • genové fůze

  • otevírání nových čtecích rámců

  • mezidruhový přenos (transformace, hybridizace, syngenese)

  • Přenos organelové DNA (promiskuitní DNA)

  • genová duplikace

  • vznik z nadbytečné kopie u diploidů

  • genomová duplikace


Obsah2
Obsah

  • materielní substrát genů

  • vnitřní periodicita genů

  • původ exonů a intronů


TACACGATACAAAAAACATGAAGATCACTGTTCTCTTTACAGTTACTGAGCACACAGGACCTCACCATGGGATGGAGCTGTATCATGCTCTTCTTGGCAGCAACAGCTACAGGTAAGGGGCTCACAGTAGCAGGCTTGAGGTCTGGACATATACATGGGTGACAATGACAATGACATCCACTTTGCCTTTCTCTCCACAGGTGTCCACTCCCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTTGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGGCGAGGCCTTGAGTGGATTGGAAGGATTGATCCTAATAGTGGTGGTACTAAGTACAATGAGAAGTTCAAGAGCAAGGCCACACTGACTGTAGACAAACCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTATTGTGCAAGACACAGTGTTGCAACCACATCCTGAGAGTGTCAGAAAACCTGGA


P vod periodicity
Původ periodicity

  • mechanismus protoreplikace

  • podporuje vznik pravidelné terciální struktury

  • adaptivní vlastnost genů související s vlastnostmi genetického kódu

  • vedlejší produkt genetického tahu


Mechanismus protoreplikace


Adaptivn vlastnost gen souvisej c s vlastnostmi genetick ho k du
Adaptivní vlastnost genů související s vlastnostmi genetického kódu

  • Větší odolnost proti posunové mutaci

  • Delší otevřené čtecí rámce u protogenů

  • Obrana proti náhodnému zahajování transkribce


V t odolnost proti posunov mutaci
Větší odolnost proti posunové mutaci genetického kódu

AATGCCAT

A

AAT GCC ATA ATG CCA TAA TGC CAT AAT GCC ATA...

AAA TGC CAT AAT GCC ATA ATG CCA TAA TGC CAT...


Adaptivn vlastnost gen souvisej c s vlastnostmi genetick ho k du1
Adaptivní vlastnost genů související s vlastnostmi genetického kódu

  • Větší odolnost proti posunové mutaci

  • Delší otevřené čtecí rámce u protogenů

  • Obrana proti náhodnému zahajování transkribce


Del otev en tec r mce u protogen
Delší otevřené čtecí rámce u protogenů genetického kódu

  • náhodné 300 nukleotidů dlouhé nukleotidové řetězce, potom jen 0,82 % z nich nebude obsahovat žádný terminační kodón a bude tak kódovat souvislý protein délky 100 aminokyselin (30x 10NK – 60%)

  • vznik nového proteinu posunem čtecího rámce

  • více čtecích rámců ve stejném úseku DNA

  • Snadnější vznik uspořádané terciální struktury


Adaptivn vlastnost gen souvisej c s vlastnostmi genetick ho k du2
Adaptivní vlastnost genů související s vlastnostmi genetického kódu

  • Větší odolnost proti posunové mutaci

  • Delší otevřené čtecí rámce u protogenů

  • Obrana proti náhodnému zahajování transkripce


Obrana proti n hodn mu zahajov n transkripce
Obrana proti náhodnému zahajování transkripce genetického kódu

  • V lidském genomu o délce 3000 Mb je přibližně 30-40 tisíc genů. To znamená, že zde jsou jednotlivé geny od sebe v průměru odděleny nekódujícími úseky DNA o délce řádově 100 tisíc nukleotidů.

  • častý motiv nekodujících úseků: AGCTG AGCTG AGCTG GGGTG.Cílové místo pro RNA polymerázu II:TATAAATA


P vod periodicity1
Původ periodicity genetického kódu

  • mechanismus protoreplikace

  • adaptivní vlastnost genů související s vlastnostmi genetického kódu

  • vedlejší produkt genetického tahu (přesah do oblasti intronů)


TACACGATACAAA genetického kóduAAACATGAAGATCACTGTTCTCTTTACAGTTACTGAGCACACAGGACCTCACCATGGGATGGAGCTGTATCATGCTCTTCTTGGCAGCAACAGCTACAGGTAAGGGGCTCACAGTAGCAGGCTTGAGGTCTGGACATATACATGGGTGACAATGACAATGACATCCACTTTGCCTTTCTCTCCACAGGTGTCCACTCCCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTTGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGGCGAGGCCTTGAGTGGATTGGAAGGATTGATCCTAATAGTGGTGGTACTAAGTACAATGAGAAGTTCAAGAGCAAGGCCACACTGACTGTAGACAAACCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTATTGTGCAAGACACAGTGTTGCAACCACATCCTGAGAGTGTCAGAAAACCTGGA

Jeden z možných důsledků existence periodicity – nerovnoměrnost v používání synonymních kodonů


Obsah3
Obsah genetického kódu

  • materielní substrát genů

  • vnitřní periodicita genů

  • původ exonů a intronů


100 genetického kódu

10

celková délka intronů (kbp)

1,0

0,1

0,3

3

30

celková délka exonů (kbp)


o genetického kódubratlovci Caenorhabditis Drosophila Neurospora Saccharomyces Coprinus mikrosporidie Distiostelium Physarum Acanthamoeba zelené rostliny Chlamydomonas ruduchy Paramecium Tetrahymena Plasmodium Toxoplasma Phytopthora Naegleria Entamoeba Leishmania Trypanosoma trichomonády diplomonády Archaebacteria Eubacteria

1 intron/kb proteinového genu


P vod intron
Původ intronů genetického kódu

  • Hypotéza časných intronů

    • introny na počátku (v RNA světě)

    • introny brzy (na počátku soužití RNA a proteinů)

  • Hypotézy pozdních intronů (až v DNA světě)

    • introny později (v DNA světě, ale před vznikem eukaryot

    • introny velmi pozdě (v rámci eukaryot)

      samovystříhávající se introny, I, II, III ?


P vod intron1
Původ intronů genetického kódu

  • Hypotéza časných intronů

    • vystřihování úseků se stop kodony

    • geny jakožto lego

    • koincidence exonů s moduly, předpovězené introny (leghemoglobin, Culex)

    • fáze intronů (faze 0 introny korelují s moduly)

    • staré a mladé introny (lepší korelace u starých)


Zastoupení jednotlivých typů intronů genetického kódu

zastoupení (%)

pozice vůči kodónům


P vod intron ii
Původ intronů II genetického kódu

  • Hypotéza pozdních intronů

    • fylogenetický předek občas neměl (přibývání intronů ve fylogenezi), ale neplatí pro řadu skupin, spíše se zdá, že první eukaryot měl mnoho intronů

    • parsimonie – opakovaný vznik

    • chabá koincidence s moduly, třídění z hlediska funkčnosti (přesun části modulu nefunkční)


Funk n v znam intron
Funkční význam intronů genetického kódu

  • Evoluční potenciál druhu (vznik nových genů)

  • Přepis více typů mRNA z jednoho genu

  • Regulace exprese (posuny na nukleosomu)



Funk n v znam intron1
Funkční význam intronů genetického kódu

  • Evoluční potenciál druhu (vznik nových genů)

  • Přepis více typů mRNA z jednoho genu

  • Regulace exprese (posuny na nukleosomu)

  • Obrana proti nelegitimní rekombinaci


Obrana proti nelegitimní rekombinaci genetického kódu

a)

paralogy s vysokým stupněm homologie

výrazná homologie - dochází k rekombinaci

nefunkční produkty nehomologické rekombinace

b)

paralogy s vysokým stupněm homologie v oblasti exonů

slabá homologie - rekombinace neprobíhá

funkční nerekombinované geny


Funk n v znam intron2
Funkční význam intronů genetického kódu

  • Evoluční potenciál druhu (vznik nových genů)

  • Přepis více typů mRNA z jednoho genu

  • Regulace exprese (posuny na nukleosomu)

  • Obrana proti nelegitimní rekombinaci

  • Detekce či odstraňování chyb

  • Žádná funkce – parazitická DNA


Shrnut
Shrnutí genetického kódu

  • Každý gen vzniká z genu

  • Geny lze uspořádat do genových rodin

  • Protein je vytvářen z modulů, ty z motivů

  • Geny často vykazují vnitřní periodicitu

  • Existence této periodicity má řadu důsledků

  • Moderní geny eukaryot jsou vytvářeny introny a exony

  • Není jasné, kdy a proč vznikl splicing, většina autorů však předpokládá, že původní geny introny neobsahovaly


ad