evoluce gen
Download
Skip this Video
Download Presentation
Evoluce genů

Loading in 2 Seconds...

play fullscreen
1 / 32

Evoluce genů - PowerPoint PPT Presentation


  • 135 Views
  • Uploaded on

Evoluce genů. Obsah. materielní substrát genů vnitřní periodicita genů původ exonů a intronů. Obsah. materielní substrát genů vnitřní periodicita genů původ exonů a intronů. Každý gen vzniká z genu. genealogické vztahy mezi geny

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Evoluce genů' - ouida


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
obsah
Obsah
  • materielní substrát genů
  • vnitřní periodicita genů
  • původ exonů a intronů
obsah1
Obsah
  • materielní substrát genů
  • vnitřní periodicita genů
  • původ exonů a intronů
ka d gen vznik z genu
Každý gen vzniká z genu
  • genealogické vztahy mezi geny
  • genové rodiny a nadrodiny – eukaryota asi 750 rodin (650-10000), každá v průměru 50 členů, 90 % velmi vzácných
  • motivy a moduly
mechanismy vzniku nov ch gen
Mechanismy vzniku nových genů
  • vznik z nekódující sekvence, vzácné u vyšších 1-5 za mil. let u savců, 5-10 za mil. let u drozofil, ale stovky u kvasinky, některé Ns/Nn > 1
  • postupná transformace a změna (nebo obohacení) funkce
  • genové fúze
  • otevírání nových čtecích rámců
  • mezidruhový přenos (transformace, hybridizace, syngenese)
  • Přenos organelové DNA (promiskuitní DNA)
  • genová duplikace (vymizení 3-7 mil. let, změna funkce)
  • Celogenomová duplikace, WGD (obratlovci 2x)
  • vznik z nadbytečné kopie u diploidů
slide6

Vznik novéhu genu u diploida

mutace

genová duplikace

crossing over

mechanismy vzniku nov ch gen1
Mechanismy vzniku nových genů
  • postupná transformace a změna (nebo obohacení) funkce
  • genové fůze
  • otevírání nových čtecích rámců
  • mezidruhový přenos (transformace, hybridizace, syngenese)
  • Přenos organelové DNA (promiskuitní DNA)
  • genová duplikace
  • vznik z nadbytečné kopie u diploidů
  • genomová duplikace
obsah2
Obsah
  • materielní substrát genů
  • vnitřní periodicita genů
  • původ exonů a intronů
slide9

TACACGATACAAAAAACATGAAGATCACTGTTCTCTTTACAGTTACTGAGCACACAGGACCTCACCATGGGATGGAGCTGTATCATGCTCTTCTTGGCAGCAACAGCTACAGGTAAGGGGCTCACAGTAGCAGGCTTGAGGTCTGGACATATACATGGGTGACAATGACAATGACATCCACTTTGCCTTTCTCTCCACAGGTGTCCACTCCCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTTGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGGCGAGGCCTTGAGTGGATTGGAAGGATTGATCCTAATAGTGGTGGTACTAAGTACAATGAGAAGTTCAAGAGCAAGGCCACACTGACTGTAGACAAACCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTATTGTGCAAGACACAGTGTTGCAACCACATCCTGAGAGTGTCAGAAAACCTGGATACACGATACAAAAAACATGAAGATCACTGTTCTCTTTACAGTTACTGAGCACACAGGACCTCACCATGGGATGGAGCTGTATCATGCTCTTCTTGGCAGCAACAGCTACAGGTAAGGGGCTCACAGTAGCAGGCTTGAGGTCTGGACATATACATGGGTGACAATGACAATGACATCCACTTTGCCTTTCTCTCCACAGGTGTCCACTCCCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTTGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGGCGAGGCCTTGAGTGGATTGGAAGGATTGATCCTAATAGTGGTGGTACTAAGTACAATGAGAAGTTCAAGAGCAAGGCCACACTGACTGTAGACAAACCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTATTGTGCAAGACACAGTGTTGCAACCACATCCTGAGAGTGTCAGAAAACCTGGA

p vod periodicity
Původ periodicity
  • mechanismus protoreplikace
  • podporuje vznik pravidelné terciální struktury
  • adaptivní vlastnost genů související s vlastnostmi genetického kódu
  • vedlejší produkt genetického tahu
adaptivn vlastnost gen souvisej c s vlastnostmi genetick ho k du
Adaptivní vlastnost genů související s vlastnostmi genetického kódu
  • Větší odolnost proti posunové mutaci
  • Delší otevřené čtecí rámce u protogenů
  • Obrana proti náhodnému zahajování transkribce
v t odolnost proti posunov mutaci
Větší odolnost proti posunové mutaci

AATGCCAT

A

AAT GCC ATA ATG CCA TAA TGC CAT AAT GCC ATA...

AAA TGC CAT AAT GCC ATA ATG CCA TAA TGC CAT...

adaptivn vlastnost gen souvisej c s vlastnostmi genetick ho k du1
Adaptivní vlastnost genů související s vlastnostmi genetického kódu
  • Větší odolnost proti posunové mutaci
  • Delší otevřené čtecí rámce u protogenů
  • Obrana proti náhodnému zahajování transkribce
del otev en tec r mce u protogen
Delší otevřené čtecí rámce u protogenů
  • náhodné 300 nukleotidů dlouhé nukleotidové řetězce, potom jen 0,82 % z nich nebude obsahovat žádný terminační kodón a bude tak kódovat souvislý protein délky 100 aminokyselin (30x 10NK – 60%)
  • vznik nového proteinu posunem čtecího rámce
  • více čtecích rámců ve stejném úseku DNA
  • Snadnější vznik uspořádané terciální struktury
adaptivn vlastnost gen souvisej c s vlastnostmi genetick ho k du2
Adaptivní vlastnost genů související s vlastnostmi genetického kódu
  • Větší odolnost proti posunové mutaci
  • Delší otevřené čtecí rámce u protogenů
  • Obrana proti náhodnému zahajování transkripce
obrana proti n hodn mu zahajov n transkripce
Obrana proti náhodnému zahajování transkripce
  • V lidském genomu o délce 3000 Mb je přibližně 30-40 tisíc genů. To znamená, že zde jsou jednotlivé geny od sebe v průměru odděleny nekódujícími úseky DNA o délce řádově 100 tisíc nukleotidů.
  • častý motiv nekodujících úseků: AGCTG AGCTG AGCTG GGGTG.Cílové místo pro RNA polymerázu II:TATAAATA
p vod periodicity1
Původ periodicity
  • mechanismus protoreplikace
  • adaptivní vlastnost genů související s vlastnostmi genetického kódu
  • vedlejší produkt genetického tahu (přesah do oblasti intronů)
slide19

TACACGATACAAAAAACATGAAGATCACTGTTCTCTTTACAGTTACTGAGCACACAGGACCTCACCATGGGATGGAGCTGTATCATGCTCTTCTTGGCAGCAACAGCTACAGGTAAGGGGCTCACAGTAGCAGGCTTGAGGTCTGGACATATACATGGGTGACAATGACAATGACATCCACTTTGCCTTTCTCTCCACAGGTGTCCACTCCCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTTGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGGCGAGGCCTTGAGTGGATTGGAAGGATTGATCCTAATAGTGGTGGTACTAAGTACAATGAGAAGTTCAAGAGCAAGGCCACACTGACTGTAGACAAACCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTATTGTGCAAGACACAGTGTTGCAACCACATCCTGAGAGTGTCAGAAAACCTGGATACACGATACAAAAAACATGAAGATCACTGTTCTCTTTACAGTTACTGAGCACACAGGACCTCACCATGGGATGGAGCTGTATCATGCTCTTCTTGGCAGCAACAGCTACAGGTAAGGGGCTCACAGTAGCAGGCTTGAGGTCTGGACATATACATGGGTGACAATGACAATGACATCCACTTTGCCTTTCTCTCCACAGGTGTCCACTCCCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTTGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGGCGAGGCCTTGAGTGGATTGGAAGGATTGATCCTAATAGTGGTGGTACTAAGTACAATGAGAAGTTCAAGAGCAAGGCCACACTGACTGTAGACAAACCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTATTGTGCAAGACACAGTGTTGCAACCACATCCTGAGAGTGTCAGAAAACCTGGA

Jeden z možných důsledků existence periodicity – nerovnoměrnost v používání synonymních kodonů

obsah3
Obsah
  • materielní substrát genů
  • vnitřní periodicita genů
  • původ exonů a intronů
slide21

100

10

celková délka intronů (kbp)

1,0

0,1

0,3

3

30

celková délka exonů (kbp)

slide22

obratlovci Caenorhabditis Drosophila Neurospora Saccharomyces Coprinus mikrosporidie Distiostelium Physarum Acanthamoeba zelené rostliny Chlamydomonas ruduchy Paramecium Tetrahymena Plasmodium Toxoplasma Phytopthora Naegleria Entamoeba Leishmania Trypanosoma trichomonády diplomonády Archaebacteria Eubacteria

1 intron/kb proteinového genu

p vod intron
Původ intronů
  • Hypotéza časných intronů
    • introny na počátku (v RNA světě)
    • introny brzy (na počátku soužití RNA a proteinů)
  • Hypotézy pozdních intronů (až v DNA světě)
    • introny později (v DNA světě, ale před vznikem eukaryot
    • introny velmi pozdě (v rámci eukaryot)

samovystříhávající se introny, I, II, III ?

p vod intron1
Původ intronů
  • Hypotéza časných intronů
    • vystřihování úseků se stop kodony
    • geny jakožto lego
    • koincidence exonů s moduly, předpovězené introny (leghemoglobin, Culex)
    • fáze intronů (faze 0 introny korelují s moduly)
    • staré a mladé introny (lepší korelace u starých)
slide25

Zastoupení jednotlivých typů intronů

zastoupení (%)

pozice vůči kodónům

p vod intron ii
Původ intronů II
  • Hypotéza pozdních intronů
    • fylogenetický předek občas neměl (přibývání intronů ve fylogenezi), ale neplatí pro řadu skupin, spíše se zdá, že první eukaryot měl mnoho intronů
    • parsimonie – opakovaný vznik
    • chabá koincidence s moduly, třídění z hlediska funkčnosti (přesun části modulu nefunkční)
funk n v znam intron
Funkční význam intronů
  • Evoluční potenciál druhu (vznik nových genů)
  • Přepis více typů mRNA z jednoho genu
  • Regulace exprese (posuny na nukleosomu)
funk n v znam intron1
Funkční význam intronů
  • Evoluční potenciál druhu (vznik nových genů)
  • Přepis více typů mRNA z jednoho genu
  • Regulace exprese (posuny na nukleosomu)
  • Obrana proti nelegitimní rekombinaci
slide30

Obrana proti nelegitimní rekombinaci

a)

paralogy s vysokým stupněm homologie

výrazná homologie - dochází k rekombinaci

nefunkční produkty nehomologické rekombinace

b)

paralogy s vysokým stupněm homologie v oblasti exonů

slabá homologie - rekombinace neprobíhá

funkční nerekombinované geny

funk n v znam intron2
Funkční význam intronů
  • Evoluční potenciál druhu (vznik nových genů)
  • Přepis více typů mRNA z jednoho genu
  • Regulace exprese (posuny na nukleosomu)
  • Obrana proti nelegitimní rekombinaci
  • Detekce či odstraňování chyb
  • Žádná funkce – parazitická DNA
shrnut
Shrnutí
  • Každý gen vzniká z genu
  • Geny lze uspořádat do genových rodin
  • Protein je vytvářen z modulů, ty z motivů
  • Geny často vykazují vnitřní periodicitu
  • Existence této periodicity má řadu důsledků
  • Moderní geny eukaryot jsou vytvářeny introny a exony
  • Není jasné, kdy a proč vznikl splicing, většina autorů však předpokládá, že původní geny introny neobsahovaly
ad