Evoluce gen
This presentation is the property of its rightful owner.
Sponsored Links
1 / 32

Evoluce genů PowerPoint PPT Presentation


  • 104 Views
  • Uploaded on
  • Presentation posted in: General

Evoluce genů. Obsah. materielní substrát genů vnitřní periodicita genů původ exonů a intronů. Obsah. materielní substrát genů vnitřní periodicita genů původ exonů a intronů. Každý gen vzniká z genu. genealogické vztahy mezi geny

Download Presentation

Evoluce genů

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Evoluce genů


Obsah

  • materielní substrát genů

  • vnitřní periodicita genů

  • původ exonů a intronů


Obsah

  • materielní substrát genů

  • vnitřní periodicita genů

  • původ exonů a intronů


Každý gen vzniká z genu

  • genealogické vztahy mezi geny

  • genové rodiny a nadrodiny – eukaryota asi 750 rodin (650-10000), každá v průměru 50 členů, 90 % velmi vzácných

  • motivy a moduly


Mechanismy vzniku nových genů

  • vznik z nekódující sekvence, vzácné u vyšších 1-5 za mil. let u savců, 5-10 za mil. let u drozofil, ale stovky u kvasinky, některé Ns/Nn > 1

  • postupná transformace a změna (nebo obohacení) funkce

  • genové fúze

  • otevírání nových čtecích rámců

  • mezidruhový přenos (transformace, hybridizace, syngenese)

  • Přenos organelové DNA (promiskuitní DNA)

  • genová duplikace (vymizení 3-7 mil. let, změna funkce)

  • Celogenomová duplikace, WGD (obratlovci 2x)

  • vznik z nadbytečné kopie u diploidů


Vznik novéhu genu u diploida

mutace

genová duplikace

crossing over


Mechanismy vzniku nových genů

  • postupná transformace a změna (nebo obohacení) funkce

  • genové fůze

  • otevírání nových čtecích rámců

  • mezidruhový přenos (transformace, hybridizace, syngenese)

  • Přenos organelové DNA (promiskuitní DNA)

  • genová duplikace

  • vznik z nadbytečné kopie u diploidů

  • genomová duplikace


Obsah

  • materielní substrát genů

  • vnitřní periodicita genů

  • původ exonů a intronů


TACACGATACAAAAAACATGAAGATCACTGTTCTCTTTACAGTTACTGAGCACACAGGACCTCACCATGGGATGGAGCTGTATCATGCTCTTCTTGGCAGCAACAGCTACAGGTAAGGGGCTCACAGTAGCAGGCTTGAGGTCTGGACATATACATGGGTGACAATGACAATGACATCCACTTTGCCTTTCTCTCCACAGGTGTCCACTCCCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTTGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGGCGAGGCCTTGAGTGGATTGGAAGGATTGATCCTAATAGTGGTGGTACTAAGTACAATGAGAAGTTCAAGAGCAAGGCCACACTGACTGTAGACAAACCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTATTGTGCAAGACACAGTGTTGCAACCACATCCTGAGAGTGTCAGAAAACCTGGA


Původ periodicity

  • mechanismus protoreplikace

  • podporuje vznik pravidelné terciální struktury

  • adaptivní vlastnost genů související s vlastnostmi genetického kódu

  • vedlejší produkt genetického tahu


Mechanismus protoreplikace


Adaptivní vlastnost genů související s vlastnostmi genetického kódu

  • Větší odolnost proti posunové mutaci

  • Delší otevřené čtecí rámce u protogenů

  • Obrana proti náhodnému zahajování transkribce


Větší odolnost proti posunové mutaci

AATGCCAT

A

AAT GCC ATA ATG CCA TAA TGC CAT AAT GCC ATA...

AAA TGC CAT AAT GCC ATA ATG CCA TAA TGC CAT...


Adaptivní vlastnost genů související s vlastnostmi genetického kódu

  • Větší odolnost proti posunové mutaci

  • Delší otevřené čtecí rámce u protogenů

  • Obrana proti náhodnému zahajování transkribce


Delší otevřené čtecí rámce u protogenů

  • náhodné 300 nukleotidů dlouhé nukleotidové řetězce, potom jen 0,82 % z nich nebude obsahovat žádný terminační kodón a bude tak kódovat souvislý protein délky 100 aminokyselin (30x 10NK – 60%)

  • vznik nového proteinu posunem čtecího rámce

  • více čtecích rámců ve stejném úseku DNA

  • Snadnější vznik uspořádané terciální struktury


Adaptivní vlastnost genů související s vlastnostmi genetického kódu

  • Větší odolnost proti posunové mutaci

  • Delší otevřené čtecí rámce u protogenů

  • Obrana proti náhodnému zahajování transkripce


Obrana proti náhodnému zahajování transkripce

  • V lidském genomu o délce 3000 Mb je přibližně 30-40 tisíc genů. To znamená, že zde jsou jednotlivé geny od sebe v průměru odděleny nekódujícími úseky DNA o délce řádově 100 tisíc nukleotidů.

  • častý motiv nekodujících úseků: AGCTG AGCTG AGCTG GGGTG.Cílové místo pro RNA polymerázu II:TATAAATA


Původ periodicity

  • mechanismus protoreplikace

  • adaptivní vlastnost genů související s vlastnostmi genetického kódu

  • vedlejší produkt genetického tahu (přesah do oblasti intronů)


TACACGATACAAAAAACATGAAGATCACTGTTCTCTTTACAGTTACTGAGCACACAGGACCTCACCATGGGATGGAGCTGTATCATGCTCTTCTTGGCAGCAACAGCTACAGGTAAGGGGCTCACAGTAGCAGGCTTGAGGTCTGGACATATACATGGGTGACAATGACAATGACATCCACTTTGCCTTTCTCTCCACAGGTGTCCACTCCCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTTGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGGCGAGGCCTTGAGTGGATTGGAAGGATTGATCCTAATAGTGGTGGTACTAAGTACAATGAGAAGTTCAAGAGCAAGGCCACACTGACTGTAGACAAACCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTATTGTGCAAGACACAGTGTTGCAACCACATCCTGAGAGTGTCAGAAAACCTGGA

Jeden z možných důsledků existence periodicity – nerovnoměrnost v používání synonymních kodonů


Obsah

  • materielní substrát genů

  • vnitřní periodicita genů

  • původ exonů a intronů


100

10

celková délka intronů (kbp)

1,0

0,1

0,3

3

30

celková délka exonů (kbp)


obratlovci Caenorhabditis Drosophila Neurospora Saccharomyces Coprinus mikrosporidie Distiostelium Physarum Acanthamoeba zelené rostliny Chlamydomonas ruduchy Paramecium Tetrahymena Plasmodium Toxoplasma Phytopthora Naegleria Entamoeba Leishmania Trypanosoma trichomonády diplomonády Archaebacteria Eubacteria

1 intron/kb proteinového genu


Původ intronů

  • Hypotéza časných intronů

    • introny na počátku (v RNA světě)

    • introny brzy (na počátku soužití RNA a proteinů)

  • Hypotézy pozdních intronů (až v DNA světě)

    • introny později (v DNA světě, ale před vznikem eukaryot

    • introny velmi pozdě (v rámci eukaryot)

      samovystříhávající se introny, I, II, III ?


Původ intronů

  • Hypotéza časných intronů

    • vystřihování úseků se stop kodony

    • geny jakožto lego

    • koincidence exonů s moduly, předpovězené introny (leghemoglobin, Culex)

    • fáze intronů (faze 0 introny korelují s moduly)

    • staré a mladé introny (lepší korelace u starých)


Zastoupení jednotlivých typů intronů

zastoupení (%)

pozice vůči kodónům


Původ intronů II

  • Hypotéza pozdních intronů

    • fylogenetický předek občas neměl (přibývání intronů ve fylogenezi), ale neplatí pro řadu skupin, spíše se zdá, že první eukaryot měl mnoho intronů

    • parsimonie – opakovaný vznik

    • chabá koincidence s moduly, třídění z hlediska funkčnosti (přesun části modulu nefunkční)


Funkční význam intronů

  • Evoluční potenciál druhu (vznik nových genů)

  • Přepis více typů mRNA z jednoho genu

  • Regulace exprese (posuny na nukleosomu)


Posun pozice regulačních elementů na nukleosomu

a)

b)


Funkční význam intronů

  • Evoluční potenciál druhu (vznik nových genů)

  • Přepis více typů mRNA z jednoho genu

  • Regulace exprese (posuny na nukleosomu)

  • Obrana proti nelegitimní rekombinaci


Obrana proti nelegitimní rekombinaci

a)

paralogy s vysokým stupněm homologie

výrazná homologie - dochází k rekombinaci

nefunkční produkty nehomologické rekombinace

b)

paralogy s vysokým stupněm homologie v oblasti exonů

slabá homologie - rekombinace neprobíhá

funkční nerekombinované geny


Funkční význam intronů

  • Evoluční potenciál druhu (vznik nových genů)

  • Přepis více typů mRNA z jednoho genu

  • Regulace exprese (posuny na nukleosomu)

  • Obrana proti nelegitimní rekombinaci

  • Detekce či odstraňování chyb

  • Žádná funkce – parazitická DNA


Shrnutí

  • Každý gen vzniká z genu

  • Geny lze uspořádat do genových rodin

  • Protein je vytvářen z modulů, ty z motivů

  • Geny často vykazují vnitřní periodicitu

  • Existence této periodicity má řadu důsledků

  • Moderní geny eukaryot jsou vytvářeny introny a exony

  • Není jasné, kdy a proč vznikl splicing, většina autorů však předpokládá, že původní geny introny neobsahovaly


  • Login