Evoluce gen
This presentation is the property of its rightful owner.
Sponsored Links
1 / 32

Evoluce genů PowerPoint PPT Presentation


  • 96 Views
  • Uploaded on
  • Presentation posted in: General

Evoluce genů. Obsah. materielní substrát genů vnitřní periodicita genů původ exonů a intronů. Obsah. materielní substrát genů vnitřní periodicita genů původ exonů a intronů. Každý gen vzniká z genu. genealogické vztahy mezi geny

Download Presentation

Evoluce genů

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Evoluce gen

Evoluce genů


Obsah

Obsah

  • materielní substrát genů

  • vnitřní periodicita genů

  • původ exonů a intronů


Obsah1

Obsah

  • materielní substrát genů

  • vnitřní periodicita genů

  • původ exonů a intronů


Ka d gen vznik z genu

Každý gen vzniká z genu

  • genealogické vztahy mezi geny

  • genové rodiny a nadrodiny – eukaryota asi 750 rodin (650-10000), každá v průměru 50 členů, 90 % velmi vzácných

  • motivy a moduly


Mechanismy vzniku nov ch gen

Mechanismy vzniku nových genů

  • vznik z nekódující sekvence, vzácné u vyšších 1-5 za mil. let u savců, 5-10 za mil. let u drozofil, ale stovky u kvasinky, některé Ns/Nn > 1

  • postupná transformace a změna (nebo obohacení) funkce

  • genové fúze

  • otevírání nových čtecích rámců

  • mezidruhový přenos (transformace, hybridizace, syngenese)

  • Přenos organelové DNA (promiskuitní DNA)

  • genová duplikace (vymizení 3-7 mil. let, změna funkce)

  • Celogenomová duplikace, WGD (obratlovci 2x)

  • vznik z nadbytečné kopie u diploidů


Evoluce gen

Vznik novéhu genu u diploida

mutace

genová duplikace

crossing over


Mechanismy vzniku nov ch gen1

Mechanismy vzniku nových genů

  • postupná transformace a změna (nebo obohacení) funkce

  • genové fůze

  • otevírání nových čtecích rámců

  • mezidruhový přenos (transformace, hybridizace, syngenese)

  • Přenos organelové DNA (promiskuitní DNA)

  • genová duplikace

  • vznik z nadbytečné kopie u diploidů

  • genomová duplikace


Obsah2

Obsah

  • materielní substrát genů

  • vnitřní periodicita genů

  • původ exonů a intronů


Evoluce gen

TACACGATACAAAAAACATGAAGATCACTGTTCTCTTTACAGTTACTGAGCACACAGGACCTCACCATGGGATGGAGCTGTATCATGCTCTTCTTGGCAGCAACAGCTACAGGTAAGGGGCTCACAGTAGCAGGCTTGAGGTCTGGACATATACATGGGTGACAATGACAATGACATCCACTTTGCCTTTCTCTCCACAGGTGTCCACTCCCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTTGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGGCGAGGCCTTGAGTGGATTGGAAGGATTGATCCTAATAGTGGTGGTACTAAGTACAATGAGAAGTTCAAGAGCAAGGCCACACTGACTGTAGACAAACCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTATTGTGCAAGACACAGTGTTGCAACCACATCCTGAGAGTGTCAGAAAACCTGGA


P vod periodicity

Původ periodicity

  • mechanismus protoreplikace

  • podporuje vznik pravidelné terciální struktury

  • adaptivní vlastnost genů související s vlastnostmi genetického kódu

  • vedlejší produkt genetického tahu


Evoluce gen

Mechanismus protoreplikace


Adaptivn vlastnost gen souvisej c s vlastnostmi genetick ho k du

Adaptivní vlastnost genů související s vlastnostmi genetického kódu

  • Větší odolnost proti posunové mutaci

  • Delší otevřené čtecí rámce u protogenů

  • Obrana proti náhodnému zahajování transkribce


V t odolnost proti posunov mutaci

Větší odolnost proti posunové mutaci

AATGCCAT

A

AAT GCC ATA ATG CCA TAA TGC CAT AAT GCC ATA...

AAA TGC CAT AAT GCC ATA ATG CCA TAA TGC CAT...


Adaptivn vlastnost gen souvisej c s vlastnostmi genetick ho k du1

Adaptivní vlastnost genů související s vlastnostmi genetického kódu

  • Větší odolnost proti posunové mutaci

  • Delší otevřené čtecí rámce u protogenů

  • Obrana proti náhodnému zahajování transkribce


Del otev en tec r mce u protogen

Delší otevřené čtecí rámce u protogenů

  • náhodné 300 nukleotidů dlouhé nukleotidové řetězce, potom jen 0,82 % z nich nebude obsahovat žádný terminační kodón a bude tak kódovat souvislý protein délky 100 aminokyselin (30x 10NK – 60%)

  • vznik nového proteinu posunem čtecího rámce

  • více čtecích rámců ve stejném úseku DNA

  • Snadnější vznik uspořádané terciální struktury


Adaptivn vlastnost gen souvisej c s vlastnostmi genetick ho k du2

Adaptivní vlastnost genů související s vlastnostmi genetického kódu

  • Větší odolnost proti posunové mutaci

  • Delší otevřené čtecí rámce u protogenů

  • Obrana proti náhodnému zahajování transkripce


Obrana proti n hodn mu zahajov n transkripce

Obrana proti náhodnému zahajování transkripce

  • V lidském genomu o délce 3000 Mb je přibližně 30-40 tisíc genů. To znamená, že zde jsou jednotlivé geny od sebe v průměru odděleny nekódujícími úseky DNA o délce řádově 100 tisíc nukleotidů.

  • častý motiv nekodujících úseků: AGCTG AGCTG AGCTG GGGTG.Cílové místo pro RNA polymerázu II:TATAAATA


P vod periodicity1

Původ periodicity

  • mechanismus protoreplikace

  • adaptivní vlastnost genů související s vlastnostmi genetického kódu

  • vedlejší produkt genetického tahu (přesah do oblasti intronů)


Evoluce gen

TACACGATACAAAAAACATGAAGATCACTGTTCTCTTTACAGTTACTGAGCACACAGGACCTCACCATGGGATGGAGCTGTATCATGCTCTTCTTGGCAGCAACAGCTACAGGTAAGGGGCTCACAGTAGCAGGCTTGAGGTCTGGACATATACATGGGTGACAATGACAATGACATCCACTTTGCCTTTCTCTCCACAGGTGTCCACTCCCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTTGTGAAGCCTGGGGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATGCACTGGGTGAAGCAGAGGCCTGGGCGAGGCCTTGAGTGGATTGGAAGGATTGATCCTAATAGTGGTGGTACTAAGTACAATGAGAAGTTCAAGAGCAAGGCCACACTGACTGTAGACAAACCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTATTGTGCAAGACACAGTGTTGCAACCACATCCTGAGAGTGTCAGAAAACCTGGA

Jeden z možných důsledků existence periodicity – nerovnoměrnost v používání synonymních kodonů


Obsah3

Obsah

  • materielní substrát genů

  • vnitřní periodicita genů

  • původ exonů a intronů


Evoluce gen

100

10

celková délka intronů (kbp)

1,0

0,1

0,3

3

30

celková délka exonů (kbp)


Evoluce gen

obratlovci Caenorhabditis Drosophila Neurospora Saccharomyces Coprinus mikrosporidie Distiostelium Physarum Acanthamoeba zelené rostliny Chlamydomonas ruduchy Paramecium Tetrahymena Plasmodium Toxoplasma Phytopthora Naegleria Entamoeba Leishmania Trypanosoma trichomonády diplomonády Archaebacteria Eubacteria

1 intron/kb proteinového genu


P vod intron

Původ intronů

  • Hypotéza časných intronů

    • introny na počátku (v RNA světě)

    • introny brzy (na počátku soužití RNA a proteinů)

  • Hypotézy pozdních intronů (až v DNA světě)

    • introny později (v DNA světě, ale před vznikem eukaryot

    • introny velmi pozdě (v rámci eukaryot)

      samovystříhávající se introny, I, II, III ?


P vod intron1

Původ intronů

  • Hypotéza časných intronů

    • vystřihování úseků se stop kodony

    • geny jakožto lego

    • koincidence exonů s moduly, předpovězené introny (leghemoglobin, Culex)

    • fáze intronů (faze 0 introny korelují s moduly)

    • staré a mladé introny (lepší korelace u starých)


Evoluce gen

Zastoupení jednotlivých typů intronů

zastoupení (%)

pozice vůči kodónům


P vod intron ii

Původ intronů II

  • Hypotéza pozdních intronů

    • fylogenetický předek občas neměl (přibývání intronů ve fylogenezi), ale neplatí pro řadu skupin, spíše se zdá, že první eukaryot měl mnoho intronů

    • parsimonie – opakovaný vznik

    • chabá koincidence s moduly, třídění z hlediska funkčnosti (přesun části modulu nefunkční)


Funk n v znam intron

Funkční význam intronů

  • Evoluční potenciál druhu (vznik nových genů)

  • Přepis více typů mRNA z jednoho genu

  • Regulace exprese (posuny na nukleosomu)


Evoluce gen

Posun pozice regulačních elementů na nukleosomu

a)

b)


Funk n v znam intron1

Funkční význam intronů

  • Evoluční potenciál druhu (vznik nových genů)

  • Přepis více typů mRNA z jednoho genu

  • Regulace exprese (posuny na nukleosomu)

  • Obrana proti nelegitimní rekombinaci


Evoluce gen

Obrana proti nelegitimní rekombinaci

a)

paralogy s vysokým stupněm homologie

výrazná homologie - dochází k rekombinaci

nefunkční produkty nehomologické rekombinace

b)

paralogy s vysokým stupněm homologie v oblasti exonů

slabá homologie - rekombinace neprobíhá

funkční nerekombinované geny


Funk n v znam intron2

Funkční význam intronů

  • Evoluční potenciál druhu (vznik nových genů)

  • Přepis více typů mRNA z jednoho genu

  • Regulace exprese (posuny na nukleosomu)

  • Obrana proti nelegitimní rekombinaci

  • Detekce či odstraňování chyb

  • Žádná funkce – parazitická DNA


Shrnut

Shrnutí

  • Každý gen vzniká z genu

  • Geny lze uspořádat do genových rodin

  • Protein je vytvářen z modulů, ty z motivů

  • Geny často vykazují vnitřní periodicitu

  • Existence této periodicity má řadu důsledků

  • Moderní geny eukaryot jsou vytvářeny introny a exony

  • Není jasné, kdy a proč vznikl splicing, většina autorů však předpokládá, že původní geny introny neobsahovaly


  • Login