Molecular Clocks

Molecular Clocks PowerPoint PPT Presentation

  • Updated On :
  • Presentation posted in: General

Evolution at the molecular level is radically different from evolution at the morphological level. Sheldon 1987, as in Futuyma 1998. Changes in the mean number of ribs in eight lineages of trilobites. Irregular but mostly gradual changes are seen in most of the lineages. TCAGAAAAACAGTTTATTTTCTTTTTTTCTGAGAGAGAGGGTCTTATTTTGTTGCCCAGGCTGGTGTGCAATGGTGCATCAGAAAAACAGTTTATTTTCTTTTTTTCTGAGTGAGAGGGTCTTATTTTGTTGCCCAGGCTGGTGTGCAATGGTGCA.

Download Presentation

Molecular Clocks

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.

- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript

  • Login