Dna fingerprinting
Download
1 / 42

DNA Fingerprinting - PowerPoint PPT Presentation


  • 412 Views
  • Updated On :

DNA Fingerprinting. Ray McGovern Nabil Hafez John Leonard. November 29, 2004. Overview. DNA Fingerprinting developed by Sir Alec J. Jeffreys, at the University of Leicester, UK. Leicestershire, saw the first exoneration and conviction bases of DNA evidence, in the late 1980s.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'DNA Fingerprinting' - orli


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
Dna fingerprinting l.jpg
DNA Fingerprinting

Ray McGovern

Nabil Hafez

John Leonard

November 29, 2004


Overview l.jpg
Overview

  • DNA Fingerprinting developed by Sir Alec J. Jeffreys, at the University of Leicester, UK.

  • Leicestershire, saw the first exoneration and conviction bases of DNA evidence, in the late 1980s.

  • We will cover:

    What is DNA Fingerprinting?

    Courts & Cases

    Probabilities associated with DNA fingerprinting


Genetics basics l.jpg
Genetics Basics

  • 100 trillion cells

  • 23 pairs of chromosomes

  • 99.9% identical between humans

  • 0.1 % or 3 million bases accounts for variation

  • Est. 20,000 – 25,000 genes

  • Up to hundreds of alleles per gene (blue or brown eyes)

Courtesy: DOE


Allelic differences l.jpg
Allelic Differences

  • Repeats vary from individual to individual but are also inherited

  • Homozygous vs Heterozygous

Courtesy: http://www.howstuffworks.com


Polymorphism variation l.jpg
Polymorphism = Variation

VNTR (minisatellites)

  • Variable number of tandem repeats

  • Repeat unit up to 25 bp (unit 20 kb)

    ACAGGGTGTGGGGACAGGGTGTGGGG

    vs

    AGTAGTAGTAGTAGTAGT

    STR (microsatellites)

  • Short tandem repeats

  • repeat unit less than 13 bp (unit <150 bp)


Where do we get the dna l.jpg
Where do we get the DNA?

  • Blood - extracted dry or wet (WBC)

  • Buccal (cheek cells) – easy to obtain

  • Semen – dried can be analyzed years later

  • Hair roots

  • Saliva

  • Skin cells


Rflp vntr based l.jpg
RFLP – VNTR based

  • Restriction Fragment Length Polymorphism

Courtesy: http://www.howstuffworks.com


Autoradiograph l.jpg
Autoradiograph

DNA evidence

Suspect 1

Courtesy: http://www.howstuffworks.com


Str pcr typing l.jpg
STR (PCR) Typing

  • Use PCR (polymerase chain reaction) to amplify DNA

  • Primer sequence

    from locus region

    (locus – chromosomal

    location of genetic

    marker or repeat)

  • Obtain Product

  • Run Gel

Courtesy: Fan Sozzi


Str multiplexing l.jpg
STR multiplexing

  • Analyzed by computer and analyst

  • This one is 8 STR loci on one gel

  • 1 in 100,000,000 discrimination

Courtesy: Genelex


Rflp vs str typing l.jpg

RFLP

Older method (80’s)

Less sensitive – suitable for blood, requires large amount of high quality DNA

Slow: 7-10 days, labor intensive, one gene analyzed at a time

Fewer indvidual tests needed, genes examined have >100 alleles high power of discrimation

STR (PCR)

Newer method (90’s)

More sensitive – can use degraded DNA from minute sources

Fast: 2-6 days, high throughput, simultaneous analysis of many genes

More individual tests needed, genes examined have between 10-15 alles, low power of discrimination

RFLP vs STR typing


Codis just like on csi l.jpg
CODIS(just like on CSI)

  • Combined DNA Index System

  • 1997 - National FBI Database composed of 13 STR Loci’s

  • Probability that DNA from unrelated individuals would generate the same 13 STR profile would be less than 1 in a trillion


Are they guilty l.jpg
Are they guilty?

  • Bands match, then that suspect is included in the group of individuals from whom the DNA evidence can come from

  • Bands don’t match, then suspect is excluded from individuals who could have contributed to the DNA evidence

  • Inconclusive – DNA possibly old or contaminated

  • Can make no statement of guilt or influence, that is for a jury to decide


The court room l.jpg
The Court Room

When determining the admissibility of DNA evidence, courts consider the following questions:

  • The way the DNA sample(s) were obtained, gathered and preserved.

  • The qualifications of the experts.

  • The status of the laboratory.

  • The reliability of the testing procedure.

    The majority of the time, “the possibility of laboratory error is substantially larger than the possibility of a coincidental match. This is not because DNA laboratory work is particularly sloppy or unreliable. Instead, it is because the chance of a coincidental match is usually small.”


Fake dna evidence l.jpg
Fake DNA Evidence

Dr. Schneeberger, a Canadian doctor who hading been acquitted of sexually assaulting in 1994, had giving blood on three occasions. He had surgically inserted a Penrose drain, filled with foreign blood and anticoagulants in his arm.

This only came to light when the police obtain a sample of his hair and Dr. Schneeberger was convicted in 1995.


Laboratories in crisis l.jpg
Laboratories in Crisis

Houston Police Department’s Crime Lab

  • 280 boxes contained evidence from 8,000 cases, items such as a human fetus, assorted body parts and a host of evidence had been stuffed into the boxes.

  • This November, it was reviled that DNA evidence from 29 cases was either missing or had been destroyed.

  • Retesting has put into question the conviction of 15 cases; including 4 death sentences.


Laboratories in crisis cont l.jpg
Laboratories in Crisis cont.

Cellmark

Cellmark was awarded a $2.7 million three-year contract to provide DNA testing service to the LA Police Department, in January.

In November, Sarah Blair a DNA analyst was fired for substituting data in control samples causing Cellmark to reanalyzed the evidence of several high-profile cases; O.J. Simpson, JonBenet Ramsey, the Unabomber, etc.

Other Labs

  • West Virginia – Fred Zain, the former director was facing fraud charges stemming from testimony provided, when he died in 2003.

  • Marysville, Washington - In November 2001, Michael Hoover a forensic scientist at the State Patrol crime lab was sentenced to 11 months, after admitting to taking heroin from case evidence; to ease him back pain.


Case law l.jpg
Case Law

The admissibility of scientific evidence in the federal court was established Frye v. United States, 1923. The Frye court put forward the "general acceptance" test.

State v. Stills – the Supreme Court of New Mexico approved the admissibility of PCR analysis stating that PCR analysis "has received overwhelming acceptance in the scientific community and the courts".


Areas of statistical calculations to considered in dna testing l.jpg
Areas of Statistical Calculations to Considered in DNA Testing

Population Genetics

  • In calculating a probability labs employ databases, which are divided into broad racial categories; comprising of the DNA profile of a few hundred individuals.

  • These databases are built on the science of Population Genetics.

  • Murder case in Vermont the defense argued that any DNA evidence should be inadmissible as there was no suitable reference database. The judge agreed, stating “it is unclear which if any of the FBI database is appropriate for calculate probability of a coincidental match.”


Areas of statistical calculations to considered in dna testing20 l.jpg
Areas of Statistical Calculations to Considered in DNA Testing

The Product Rule

  • The product rule is employed in determining a match.

  • Guidelines for the application of the product rule are detailed in the Recommendations 4.1 in the Second National Research Council Report (NRC II).

    “The product rule requires an assumption of within (Hardy-Weinberg or HW) and between (linkage equilibrium or LE) locus independence, which cannot be exactly true.”


The ceiling principle and the modified ceiling principle l.jpg
The Ceiling Principle and the Modified Ceiling Principle Testing

The National Academy of Sciences first recommended the use of the Ceiling Principle back in the late 1980s. The idea was to provide the most conservative estimate of probability but in the mid 1990 it fell out of favor

Advances in DNA fingerprinting

  • In the eighties the number of VNTRs used was small, four or less compared to today when the norm is to employ at least six loci.

    A Shift in the scientific landscape,

  • Randjit Chakraborty and Kenneth Kidd defended DNA statistical analysis in their paper entitled The Utility of DNA Typing in Forensic Work. They asserted that even a small amount of migration (gene) across populations is quickly homogenized and contested Lewontin and Hartle’s ideas.

  • In 1994, Bruce Budowle and Eric Lander published a paper in they concluded that any controversy had been resolved by the Technical Working Group on DNA Analysis Methods (TWGDAM); sponsored by the FBI and the Department of Justice.



Cells chromosomes genes l.jpg

Cells, Chromosomes, Genes Testing

23 pairs of chromosomes

Each set passed from parents, one from each

Inherited characteristics controlled by genes


Inheritance l.jpg
Inheritance Testing

Genes can come in alternative forms, alleles

Each controls specific trait, example: eye color

brown, green, blue

One allele from each parent

Dominant vs. Recessive


Slide25 l.jpg

Recessive: Sickle Cell Anemia Testing

Allele causes shape of red blood cells to be altered

2 copies - disease is manifested

1 copy - carrier


Dominant huntington s disease l.jpg
Dominant: Huntington’s Disease Testing

Progressive, usually mid 30’s

Involuntary muscular action and dementia

Only 1 copy of allele needed


Two different genes l.jpg
Two different Genes Testing

What happens when at a given locus

Both Dominant & Recessive alleles present


The hardy weinberg equilibrium l.jpg
The Hardy-Weinberg Equilibrium Testing

1908

Godfrey Harold Hardy - mathematician

Wilhelm Weinberg - physician

Mathematical equivalent of Mendel’s observations

on heredity


Phenotypes l.jpg
Phenotypes: Testing

For a gene with 2 alleles, A and a

p the population frequency of A

q the population frequency of a


Cross product l.jpg
Cross Product Testing

A a

A AA Aa

a Aa aa

AA = 25% Aa = 50% aa = 25%


Genotypes l.jpg
Genotypes Testing

AA =

Aa =

Aa =


Restrictions l.jpg
Restrictions Testing

Population size infinite

Random mating

No selection for or against genotypes

No mutations

No net migration into or out of population


Applications of hardy weinberg l.jpg
Applications of Hardy-Weinberg Testing

DNA Forensics

Population Genetics


Forensics l.jpg
Forensics Testing

DNA exclusion

no match

DNA inclusion

match but need to relate to

population frequencies


Frequency l.jpg
Frequency Testing

Each allele has an observed frequency

Use the product rule

Blond hair: 1/10

Blue eyes: 1/10

Fair skin: 1/10

(.10) (.10) (.10) = 1/1000

What about in Scandinavia? Issue of population


Confidence levels l.jpg
Confidence Levels Testing

95% confidence limit, true value has only

5% chance exceeding upper bound

If pattern 1/100

Frequency .01

Upper confidence limit 4.7%


Population differences l.jpg
Population differences Testing

A a

Group I - 90% .5 .5

Group II - 10% .9 .1

with random mating

AA Aa aa

Group I .25 .50 .25

Group II .81 .18 .01


The results not that different l.jpg
The Results, not that different Testing

Observed genotype

AA=(.9)(.25)+(.1)(.81) =.306

Aa=(.9)(.5) +(.1)(.18) =.468

aa=(.9)(.25) +(.1)(.01) =.226

Without regard to population substructure

A=(.9)(.5)+(.1)(.9) =.54

a=(.9)(.5)+(.1)(.1) =.46

Hardy-Weinberg proportions

AA=(.54)(.54) =.2916

Aa=2(.54)(.46) =.4968

aa=(.46)(.46) =.2116

http://www.dartmouth.edu/~chance/teaching_aids/books_articles/DNAtyping/node1.html


Population genetics l.jpg
Population Genetics Testing

Sickle Cell Anemia

observed frequency : 0.09

p + q = 1

q = % population with SCA = .09

p = % population with out SCA = .91


Expected frequencies l.jpg
Expected Frequencies Testing

Genotype frequencies


Conclusion l.jpg
Conclusion Testing

Hardy-Weinberg Equilibrium is a powerful tool

Pay attention to its constraints


References l.jpg
References Testing

  • i http://www.bbc.co.uk/crime/caseclosed/colinpitchfork.shtml

  • ii http://en.wikipedia.org

  • iii On Conveying the Probative Value of DNA Evidence: Frequencies, Likelihood Ratios, and Error Rates, by Jonathan J. Koehler, The University of Texas at Austin, 20th March 1996

  • iv http://www.medterms.com/

  • v http://www.cnn.com/2004/TECH/science/11/18/dnalab.ap/index.html

  • vi http://www.law-forensic.com/cfr_gen_art_24.htm

  • vii http://www.cellmark-labs.com/

  • viii Labs Placed Under a Microscope, by Robert Tanner, The Washington Post, July 27, 2003

  • ix http://www.illinoisbar.org/Member/mar00lj/p134.htm#2

  • x http://www.kscourts.org/ca10/cases/2001/03/00-2475.htm

  • xi http://www.forensic-evidence.com/site/EVID/EL_dna_instr_bad.html

  • xii http://www.fathom.com/course/21701758/session4.html

  • xiii Interpreting DNA Mixtures Based on the NRC-II Recommendation 4.1, by Wing K. Fung and Yue-Qing Hu, Forensic Science Communication, Volume 2 - Number 4, October 2000

  • xiv Commonwealth v. Lanigan, 419 Mass. 15 (1994)

  • xv Utility of DNA Typing in Forensic Work, by Randjit Chakraborty and Kenneth Kidd, Science 20th December 1991, Vol, 254, Issue 5039

  • xvi http://www.nas.edu/

  • xvii Use of DNA Profiles in Criminal Proceeding, Alaska Judicial Council, December 1996

  • xviii Dr. Shockley and Mr. Hyde, by Joseph Galloway et al, News & World Report, 28th Aug 1989

  • xvii http://www.law.berkeley.edu/journals/btlj/articles/vol8/Denemark/html/reader.html

  • xv Milton R. Wessel, Adversary Science and the Adversary Scientist: Threats to Responsible Dispute Resolution, 28 JURIMETRICS J. 379, 380 (1988).


ad