1 / 18

TEAM ANTIDOTE Analyzing New Treatments for Infectious Diseases with Obtained Therapeutic Extracts

TEAM ANTIDOTE Analyzing New Treatments for Infectious Diseases with Obtained Therapeutic Extracts. Noha Eshera Song Fu Angela Hou Liv Johannessen Rahel Kifle Nathan King Eunsol Lee. Mentor: Dr. Andrea Ottesen. Ke Ma Gowri Nadmichettu Alex Peters Greg Polley Steven Ramiro

oria
Download Presentation

TEAM ANTIDOTE Analyzing New Treatments for Infectious Diseases with Obtained Therapeutic Extracts

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. TEAM ANTIDOTEAnalyzing New Treatments for Infectious Diseases with Obtained Therapeutic Extracts NohaEshera Song Fu Angela Hou LivJohannessen RahelKifle Nathan King Eunsol Lee Mentor: Dr. Andrea Ottesen Ke Ma GowriNadmichettu Alex Peters Greg Polley Steven Ramiro Crystal Wang Alex Zhang

  2. Overview of Our Presentation • Literature Review • Global Impact of HIV and HCV • The plant – Phyllanthusniruri • Research questions • Outline of Methodology • Genetics • Biochemistry • Cell assays • Timeline • Acknowledgements

  3. HIV infection HCV infection Literature review:Global Impact of HIV and HCV • 33.2 million HIV infected people • HIV: retrovirus  immune system failure = AIDS • 30% also co-infected with Hepatitis C (HCV) • HCV: infectious liver disease • can cause liver failure or cirrhosis (scarring) • Why study HIV/HCV Co-infection? • HCV progression is faster • Difficult for HCV patients to tolerate HIV medication • Only modest cure rates

  4. Cocktail of pharmaceutical drugs Many negative side effects, particularly with Hepatitis C treatment (Kottilil, Jackson, & Polis, 2005) Literature review: Current treatment Insomnia Cognitive changes Anorexia Interferon-alpha for Hepatitis C Weight loss Depression Hair loss Irritability Skin rash

  5. Literature Review: Phyllanthusniruri • Native species to the tropics • Acquiring the plant seeds from various sources • Used in traditional herbal medicine • Treat various diseases of the liver, kidney, gallbladder • Current research has shown potential antiviral properties • Anti-HIV – Niruriside (Qian-Cutroneet al., 1996) • Anti-Hepatitis B – Clinical trial in hepatitis B patients (Xin-Hua, Chang-Qing, Xing-Bo, & Lin-Chun, 2001). • Protects the liver – therapeutic effects reported in response to oxidative stress (Chatterjee& Sil, 2006) • Species confusion in Phyllanthus genus

  6. Research Questions • What active compounds are present in Phyllanthusniruri and how do these compounds affect the viral load and cell viability?   • What is the effect of chemical compounds found in extracts from Phyllanthusniruriwhen combined and compared with medicines used in conventional treatment of HIV and HCV, specifically, T-20 for HIV and interferon alpha for HCV?

  7. Liver cell or white blood cell Virus Alive Dead Outline of Methodology • DNA barcoding of PhyllanthusNiruri • Extraction of active chemical compounds • Testing the chemical compounds on HIV and HCV cell lines • Identification of the specific active compounds with therapeutic effects OR

  8. DNA Barcoding • Identification of species within Phyllanthus genus • DNA barcoding uses genes that are common to all plants of the same genus but establishes variability • Will be able to ensure plant usage consistency

  9. DNA Barcoding DNA Extraction Polymerase Chain Reaction (PCR) Sequencing 5’ GATCTGCATGAGTTAAGTGTAGCG 3’

  10. Extractions Solvent 1 H2O, Methanol, Ethanol, etc. Leaf Solvent 3 Solvent 2 Root Whole plant

  11. Cell culture studies Negative control: Infected cells; no treatment Plant concentration #1 Plant concentration #2 Positive control: Conventional drugs Plant concentration #4 Plant concentration #3

  12. Measuring effectiveness of treatment • Over 7-10 days, we will monitor: • Viability of the cells • Are cells dying as a result of the treatment? Alive Plant extract OR Virus Dead Liver cell or white blood cell

  13. Measuring effectiveness of treatment Viral levels How much is virus is produced as a result of the treatment? Do viral levels decrease, stay the same, or increase? OR Plant extract Liver cell or white blood cell Virus

  14. Test the following for effectiveness to maintain viability and decrease viral levels Different plant extracts Combinations of extracts Extracts with conventional drugs Measuring effectiveness of treatment Liver cell or white blood cells

  15. Chemical analysis Carbon-13 NMR H NMR IR Spectrometry HPLC

  16. Timeline • Fall 2009 • Methodology • Begin Growing Plant • Spring 2010 • Begin Extractions • Molecular Barcoding • Identify Plant • Fall 2010 • Continue Molecular Barcoding • Begin Cell Culture Studies • Junior Colloquium • Spring 2011 • Continue cell culture studies • Complete data Collection • Undergraduate Research Day • Fall 2012 • Complete data analysis • Write thesis draft • Spring 2012 • Complete team thesis • Team thesis conference

  17. Acknowledgments • Mentor: Dr. Andrea Ottesen • Dr. ShyamKottilil, NIH, NIAID • Dr. James Duke • Librarian: Tom Harrod • US Botanical Gardens • Dr. James Wallace • Dr. Rebecca Thomas • Courtney Barrett • SL: Neelam Parikh

  18. QUESTIONS?

More Related