180 likes | 250 Views
TEAM ANTIDOTE Analyzing New Treatments for Infectious Diseases with Obtained Therapeutic Extracts. Noha Eshera Song Fu Angela Hou Liv Johannessen Rahel Kifle Nathan King Eunsol Lee. Mentor: Dr. Andrea Ottesen. Ke Ma Gowri Nadmichettu Alex Peters Greg Polley Steven Ramiro
E N D
TEAM ANTIDOTEAnalyzing New Treatments for Infectious Diseases with Obtained Therapeutic Extracts NohaEshera Song Fu Angela Hou LivJohannessen RahelKifle Nathan King Eunsol Lee Mentor: Dr. Andrea Ottesen Ke Ma GowriNadmichettu Alex Peters Greg Polley Steven Ramiro Crystal Wang Alex Zhang
Overview of Our Presentation • Literature Review • Global Impact of HIV and HCV • The plant – Phyllanthusniruri • Research questions • Outline of Methodology • Genetics • Biochemistry • Cell assays • Timeline • Acknowledgements
HIV infection HCV infection Literature review:Global Impact of HIV and HCV • 33.2 million HIV infected people • HIV: retrovirus immune system failure = AIDS • 30% also co-infected with Hepatitis C (HCV) • HCV: infectious liver disease • can cause liver failure or cirrhosis (scarring) • Why study HIV/HCV Co-infection? • HCV progression is faster • Difficult for HCV patients to tolerate HIV medication • Only modest cure rates
Cocktail of pharmaceutical drugs Many negative side effects, particularly with Hepatitis C treatment (Kottilil, Jackson, & Polis, 2005) Literature review: Current treatment Insomnia Cognitive changes Anorexia Interferon-alpha for Hepatitis C Weight loss Depression Hair loss Irritability Skin rash
Literature Review: Phyllanthusniruri • Native species to the tropics • Acquiring the plant seeds from various sources • Used in traditional herbal medicine • Treat various diseases of the liver, kidney, gallbladder • Current research has shown potential antiviral properties • Anti-HIV – Niruriside (Qian-Cutroneet al., 1996) • Anti-Hepatitis B – Clinical trial in hepatitis B patients (Xin-Hua, Chang-Qing, Xing-Bo, & Lin-Chun, 2001). • Protects the liver – therapeutic effects reported in response to oxidative stress (Chatterjee& Sil, 2006) • Species confusion in Phyllanthus genus
Research Questions • What active compounds are present in Phyllanthusniruri and how do these compounds affect the viral load and cell viability? • What is the effect of chemical compounds found in extracts from Phyllanthusniruriwhen combined and compared with medicines used in conventional treatment of HIV and HCV, specifically, T-20 for HIV and interferon alpha for HCV?
Liver cell or white blood cell Virus Alive Dead Outline of Methodology • DNA barcoding of PhyllanthusNiruri • Extraction of active chemical compounds • Testing the chemical compounds on HIV and HCV cell lines • Identification of the specific active compounds with therapeutic effects OR
DNA Barcoding • Identification of species within Phyllanthus genus • DNA barcoding uses genes that are common to all plants of the same genus but establishes variability • Will be able to ensure plant usage consistency
DNA Barcoding DNA Extraction Polymerase Chain Reaction (PCR) Sequencing 5’ GATCTGCATGAGTTAAGTGTAGCG 3’
Extractions Solvent 1 H2O, Methanol, Ethanol, etc. Leaf Solvent 3 Solvent 2 Root Whole plant
Cell culture studies Negative control: Infected cells; no treatment Plant concentration #1 Plant concentration #2 Positive control: Conventional drugs Plant concentration #4 Plant concentration #3
Measuring effectiveness of treatment • Over 7-10 days, we will monitor: • Viability of the cells • Are cells dying as a result of the treatment? Alive Plant extract OR Virus Dead Liver cell or white blood cell
Measuring effectiveness of treatment Viral levels How much is virus is produced as a result of the treatment? Do viral levels decrease, stay the same, or increase? OR Plant extract Liver cell or white blood cell Virus
Test the following for effectiveness to maintain viability and decrease viral levels Different plant extracts Combinations of extracts Extracts with conventional drugs Measuring effectiveness of treatment Liver cell or white blood cells
Chemical analysis Carbon-13 NMR H NMR IR Spectrometry HPLC
Timeline • Fall 2009 • Methodology • Begin Growing Plant • Spring 2010 • Begin Extractions • Molecular Barcoding • Identify Plant • Fall 2010 • Continue Molecular Barcoding • Begin Cell Culture Studies • Junior Colloquium • Spring 2011 • Continue cell culture studies • Complete data Collection • Undergraduate Research Day • Fall 2012 • Complete data analysis • Write thesis draft • Spring 2012 • Complete team thesis • Team thesis conference
Acknowledgments • Mentor: Dr. Andrea Ottesen • Dr. ShyamKottilil, NIH, NIAID • Dr. James Duke • Librarian: Tom Harrod • US Botanical Gardens • Dr. James Wallace • Dr. Rebecca Thomas • Courtney Barrett • SL: Neelam Parikh