PODSTAWOWE  TECHNIKI
This presentation is the property of its rightful owner.
Sponsored Links
1 / 76

PODSTAWOWE TECHNIKI stosowane w BIOLOGII MOLEKULARNEJ PowerPoint PPT Presentation


  • 167 Views
  • Uploaded on
  • Presentation posted in: General

PODSTAWOWE TECHNIKI stosowane w BIOLOGII MOLEKULARNEJ. ENZYMY RESTRYKCYJNE ENDONUKLEAZY RESTRYKCYJNE RESTRYKTAZY. S ą to enzymy należące do hydrolaz. Stanowią grupę wyodrębnioną spośród D N az. Charakteryzują się tym, że rozpoznają konkretne

Download Presentation

PODSTAWOWE TECHNIKI stosowane w BIOLOGII MOLEKULARNEJ

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Podstawowe techniki stosowane w biologii molekularnej

PODSTAWOWE TECHNIKI

stosowane w

BIOLOGII MOLEKULARNEJ


Podstawowe techniki stosowane w biologii molekularnej

ENZYMY RESTRYKCYJNE

ENDONUKLEAZY RESTRYKCYJNE

RESTRYKTAZY

  • Są to enzymy należące do hydrolaz.

  • Stanowią grupę wyodrębnioną spośród DNaz.

  • Charakteryzują się tym, że rozpoznają konkretne

  • sekwencje w obrębie dwuniciowego DNA i często

  • hydrolizują konkretne wiązanie.


Podstawowe techniki stosowane w biologii molekularnej

Nagroda Nobla w dziedzinie medycyny/fizjologii

1978

“for the discovery of restriction enzymes and their application to problems of molecular genetics”

Werner Arber, Daniel Nathans, Hamilton O. Smith

Szwajcar

Amerykanie


Podstawowe techniki stosowane w biologii molekularnej

Enzymy restrykcyjne

  • Zostały odkryte jako enzymy bakteryjne rozkładające fagi wnikające do komórek bakteryjnych.

  • W komórkach bakteryjnych w parze z każdą endonukleazą restrykcyjną występuje metylotransferaza rozpoznająca dokładnie tę samą sekwencję. Metylotransferaza metyluje niektóre zasady w obrębie tej sekwencji i w ten sposób zabezpiecza bakteryjny DNA przed strawieniem przez własny enzym restrykcyjny.

  • Taka para enzymów tworzy system R-M -system restrykcja-modyfikacja (ang. restriction-modification system).


Podstawowe techniki stosowane w biologii molekularnej

Schemat działania systemu R – M na przykładzie restryktaz typu I

SAM - S-adenozylo-metionina

Curr. Opin. Microbiol.2005, 8:466–472, Tock MR. and Dryden DRF: The biology of restriction and anti-restriction.


Podstawowe techniki stosowane w biologii molekularnej

Enzymy restrykcyjne

  • Znamy ponad 3000 restryktaz o250 różnych specyficznościach. Izoschizomery to enzymy pochodzące z różnych bakterii, ale wykazujące tę samą specyficzność (np. EcoRI i FunII rozpoznają i hydrolizują w ten sam sposób sekwencję: GAATCC)

  • Restryktazy to enzymy bardzo różnorodne pod względem wielkości i sekwencji aminokwasowej.

  • Na przykład:

  • Enzym Pvu II - 157 aminokwasów (18 kDa)

  • Enzym Cje I – 1250 aminokwasów (145 kDa)


Podstawowe techniki stosowane w biologii molekularnej

Enzymy restrykcyjne

Nazwa każdego enzymu pochodzi od skrótów nazw bakterii, z których dany enzym wyizolowano + numer (rzymski).


Podstawowe techniki stosowane w biologii molekularnej

Enzymy restrykcyjne

Wyróżnia się 4 typy enzymów restrykcyjnych: I, II, III, IV

Przede wszystkim enzymy typu II są stosowane w biologii molekularnej, bo tylko one hydrolizują wiązanie w obrębie rozpoznawanej sekwencji.

Rozpoznają sekwencje palindromowe, 4-8 nukleotydowe.

Palindrom: słowo, zdanie, wiersz, które mają to samo znaczenie czytane normalnie i wspak.

Klasyczne: Kobyła ma mały bok

Współczesne: A ma bok cara Barack Obama


Podstawowe techniki stosowane w biologii molekularnej

Palindromy DNA są nietypowe – musimy uwzględnić to, że DNA jest dwuniciowy

Popija rum As, samuraj i popJulian Tuwim

POPIJARUMAS ----------------------

---------------------- SAMURAJIPOP


Podstawowe techniki stosowane w biologii molekularnej

Przykładowe sekwencje rozpoznawane przez enzymy restrykcyjne

5’-GGCC-3’

3’-CCGG-5’

5’-TCGCGA-3’

3’-AGCGCT-5’

5’-GCGGCCGC-3’

3’-CGCCGGCG-5’

Enzymy restrykcyjne typu II

są zwykle homodimerami

(Dlaczego?)

http://en.wikipedia.org/wiki/Restriction_enzyme


Podstawowe techniki stosowane w biologii molekularnej

Odp. prawidłowa:

5’ A T T A A T 3’

3’ T A A T T A 5’

Odp. nieprawidłowe:

5’ A T T T T A 3’

3’ T A A A A T 5’

5’ A T T T T A 3’

3’ A T T T T A 5’

Pytania na egzamin:

1. Uzupełnij sekwencję DNA rozpoznawaną przez typowy enzym restrykcyjny:

5’ A T T ––– 3’

3’ –––––– 5’


Podstawowe techniki stosowane w biologii molekularnej

2. We fragmencie pojedynczej nici DNA znajdź i podkreśl potencjalne miejsca restrykcyjne:

CAAGCTTGCATGCCCGGGAATTCA

CAAGCTTGCATGCCCGGGAATTCA


Podstawowe techniki stosowane w biologii molekularnej

5’-CCCGGG-3’

3’-GGGCCC-5’

Enzymy restrykcyjne typu II mogą hydrolizować wiązanie w miejscu osi symetrii rozpoznawanej sekwencji.

Powstają wówczas niekohezyjne (tępe) końce DNA

5’- AGCT-3 ’

3’- TCGA -5’

Sma I Alu I


Podstawowe techniki stosowane w biologii molekularnej

...lub hydrolizują wiązania poza osią symetrii rozpoznawanej sekwencji.

Powstają wówczaskohezyjne (lepkie)końce DNA


Podstawowe techniki stosowane w biologii molekularnej

Zarówno przy powstawaniu lepkich jak i tępych końców – wiązanie fosfodiestrowe jest hydrolizowane tak, że na 3’ końcu pozostaje grupa –OH a na 5’ końcu grupa fosforanowa.


Podstawowe techniki stosowane w biologii molekularnej

Co to jest aktywność enzymatyczna? – definicja

Jak można zdefiniować aktywność enzymu restrykcyjnego?

Definicja musi być na tyle uniwersalna, aby naukowiec mógł porównać preparaty enzymów oferowane przez różne firmy.

Np. Firma X oferuje 500U NotI za 200€

Firma Y oferuje 1000U NotI za 320€

Kupię enzym z firmy Y pod warunkiem, że obie firmy posługują się taką samą definicją U dla enzymów restrykcyjnych.


Podstawowe techniki stosowane w biologii molekularnej

Jedna jednostka aktywności (U) enzymu restrykcyjnego

to taka jego ilość, która jest potrzebna

do całkowitego strawienia

1 mg DNA faga l*rozpuszczonego w 50 ml

w ciągu 60 min

w warunkach optymalnych dla działania enzymu

(temperatura, bufor)

Wszystkie enzymy typu II wymagają do swojej aktywności jonów Mg2+

Aktywność enzymów restrykcyjnych

*lub inny DNA zawierający dane miejsce restrykcyjne


Podstawowe techniki stosowane w biologii molekularnej

  • Niektóre enzymy typu II wykazują niższą specyficzność:

  • Np. Hinc II rozpoznaje sekwencje GT[PyPu]AC, a więc:

  • GTTAAC, GTCGAC, GTTGAC, GTCAAC

  • Niektóre enzymy typu II rozpoznają nieciągłe sekwencje palindromowe:

  • Np. Bgl I rozpoznaje sekwencję: GCCNNNNNGGC


Podstawowe techniki stosowane w biologii molekularnej

Ewolucja niektórych enzymów restrykcyjnych

zachodziła przez horyzontalny transfer genów

Escherichia coli Bacillus amyloli

4 konserwatywne elementy strukturalne


Podstawowe techniki stosowane w biologii molekularnej

Skąd można wnioskować, że dany gen pojawił się w wyniku horyzontalnego transferu genów?

Jedną z przesłanek może być wynik analizy wykorzystania kodonów, gdyż różne organizmy w różnym stopniu wykorzystują różne kodony.


Podstawowe techniki stosowane w biologii molekularnej

Ciekawostka:

Nie wszystkie enzymy restrykcyjne rozpoznają sekwencje palindromowe. Np. enzym BbvC I: rozpoznaje sekwencję CCTCAGC

Jak to jest możliwe?

Bo enzym nie występuje jako homo- lecz jako heterodimer.


Podstawowe techniki stosowane w biologii molekularnej

  • Jak można wykorzystać enzymy restrykcyjne?

  • Manipulacja odcinkami DNA o znanych sekwencjach – możemy w konkretnych miejscach przecinać DNA (a potem dzięki innemu enzymowi, ligazie, łączyć dowolne uzyskane fragmenty) – klonowanie molekularne

  • Możemy identyfikować konkretne sekwencje w obrębie danego DNA – analiza restrykcyjna

Klonowanie molekularne = tworzenie rekombinowanych DNA


Podstawowe techniki stosowane w biologii molekularnej

Analiza restrykcyjna rejonu promotorowego genu ADAM17 (praca magisterska Magdy Strzeleckiej)

S K H B E/B S

E H

B

S – standard wielkości

K – kontrola, fragment DNA niepoddany trawieniu

H – Hind III

E – Eco RI

B – Bam HI

Negatyw żelu agarozowego wybarwionego EtBr


Podstawowe techniki stosowane w biologii molekularnej

Analiza restrykcyjna pozwala na wykrywanie niektórych chorób dziedzicznych.

Metoda RFLP

(ang.Restriction Fragment Lenght Polymorphism)

Istotne jest, aby mutacja powodująca chorobę występowała w obrębie sekwencji rozpoznawanej przez enzym restrykcyjny.

Można wykrywać np. pląsawicę Huntingtona, anemię sierpowatą, mukowiscydozę.


Podstawowe techniki stosowane w biologii molekularnej

Anemia sierpowata

Spowodowana mutacją punktową w genie kodującym łańcuchbhemoglobiny

www.mun.ca/biology/desmid/brian/BIOL2250/Week_Three/ssaRBC.jpg


Podstawowe techniki stosowane w biologii molekularnej

Przerywamy na chwilę opowieść o RFLP

Jak wykrywać określone sekwencje DNA?

Southern blotting

  • Poddajemy genomowy DNA trawieniu restrykcyjnemu (uzyskujemy bardzo wiele różnych fragmentów).

  • Poddajemy DNA elektroforezie.

  • Denaturujemy (alkaliczna denaturacja).

  • Przenosimy DNA na filtr nitrocelulozowy lub PVDF*.

  • Hybrydyzujemy z sondą wyznakowaną radioizotopowo (jeden z nukleotydów zawiera 32P).

  • Odpłukujemy niespecyficznie związaną sondę.

  • Filtr poddajemy autoradiografii.

technika opracowana przez sir Edwina Southerna *PVDF – polifluorek winylidenu


Podstawowe techniki stosowane w biologii molekularnej

Po denaturacji i hybrydyzacji:

Southern blotting

Sonda to odcinek dwuniciowego DNA o sekwencji identycznej (a więc i komplemetarnej) do fragmentu sekwencji DNA, którą chcemy wykryć.

wykrywana sekwencja sonda


Podstawowe techniki stosowane w biologii molekularnej

Wracamy do wykrywania anemii sierpowatej


Podstawowe techniki stosowane w biologii molekularnej

Mst II

zdrowy

chory

mutacja

  • - zdrowy

  • - chory

  • - chory (heterozygota)

Southern blot

Sonda komplementarna do fragmentu genu kodującego łańcuch b hemoglobiny


Podstawowe techniki stosowane w biologii molekularnej

Technika Northern blotting

Polega na hybrydyzacji znakowanej sondy z cząsteczkami RNA unieruchomionymi na membranie.

Pozwala na określanie poziomu specyficznych

mRNA w komórkach określonego typu w określonych warunkach (badanie transkryptomu).

Technika Northern blotting będzie dokładnie omówiona na wykładzie z Genetyki molekularnej


Podstawowe techniki stosowane w biologii molekularnej

Southern blotting - hybrydyzacja DNA-DNA

(od nazwiska Edwina Southerna)

Northern blotting - hybrydyzacja RNA-DNA

Western blotting - wykrywanie konkretnych białek przez przeciwciała

  • Eastern blotting – termin się wykluwa – co się przyjmie?

  • Wykrywanie glikozydów unieruchomionych na membranie (np. po chromatografii) przez przeciwciała

  • Wykrywanie różnych potranslacyjnych modyfikacji białek przez przeciwciała (lub innymi metodami)

  • Wykrywanie białek przez aptamery (oligonukleotydy) znakowane radioizotopowo lub fluorescencyjnie


Podstawowe techniki stosowane w biologii molekularnej

Sekwencjonowanie DNA

  • Metoda chemiczna Maxama-Gilberta (już raczej nie używana)

  • Metoda enzymatyczna Sangera;

  • (metoda z użyciem dideoksynukleotydów)

Metoda Sangera:

Prowadzimy reakcję syntezy DNA na matrycy DNA w czterech probówkach. Do mieszaniny reakcyjnej dodaje się niewielkiej ilości dideoksynukleotydu (do każdej probówki innego). Wbudowanie ddNTPzatrzymuje reakcję polimeryzacji (brak grupy –OH przy C3’). Powstają odcinki DNA różnej długości, które analizuje się elektroforetycznie.

Walter Gilbert i Frederick Sanger – 1980 – otrzymali po ¼ Nagrody Nobla z chemii

(1/2 otrzymał Paul Berg za rekombinację DNA)


Podstawowe techniki stosowane w biologii molekularnej

Dideoksynukleotyd

Jeśli w trakcie syntezy do DNA zostanie wbudowany dideoksynukleotyd to synteza zatrzymuje się. Brak grupy -OH przy C-3’ uniemożliwia przyłączenie kolejnego nukleotydu.


Podstawowe techniki stosowane w biologii molekularnej

Sekwencjonowanie DNA – metoda Sangera

5’-ATGTCAGTCCA-3’


Podstawowe techniki stosowane w biologii molekularnej

Przykładowe sekwencjonowanie

Prawy panel – typowy obraz „przeciętnego” fragmentu DNA

Lewy panel – sekwencja bogata w nukleotydy G i C. Długi fragment o sekwencji złożonej z powtórzeń GGC.

http://www.cambio.co.uk/l3.php?l1_category_id=3&l2_category_id=93


Podstawowe techniki stosowane w biologii molekularnej

  • Warianty metody Sangera

  • Zamiast znakowanego deoksynukleotydu można stosować znakowany starter.

  • Zamiast znakowania izotopem (32P lub 35S) można znakować starter znacznikiem fluorescencyjnym.

  • Można również znakować fluorescencyjnie dideoksynukleotydy – każdy innym znacznikiem i reakcję polimeryzacji prowadzić w jednej probówce.


Podstawowe techniki stosowane w biologii molekularnej

Sekwencjonowanie DNA może być zautomatyzowane

- sekwenatory DNA

Intensywność fluorescencji

Kolejne nukleotydy w sekwencji


Podstawowe techniki stosowane w biologii molekularnej

Po nałożeniu czterech wykresów uzyskujemy przykładowy następujący obraz:


Podstawowe techniki stosowane w biologii molekularnej

Porównanie klasycznej metody Sangera z wariantem gdzie dideoksynukleotydy są znakowane różnymi barwnikami fluorescencyjnymi:

http://www.steve.gb.com/images/science/dna_fluorescent_sequencing.png


Podstawowe techniki stosowane w biologii molekularnej

Sekwencjonowanie genomów

Ciekawostka: największy poznany genom ma Polychaos dubium (ameba) (6,7 x 1011) (informacja stara, niepotwierdzona), a wśród kręgowców - prapłetwiec abisyński (1,3 x 1011).


Podstawowe techniki stosowane w biologii molekularnej

  • Metoda Maxama i Gilberta

  • Metoda chemiczna.

  • Znakuje się jeden koniec DNA (32P).

  • Rozdziela się DNA do 4 probówek i poddaje działaniu 4 różnych związków chemicznych, które modyfikują konkretne zasady: G, A+G, C, C+T.

  • Ta modyfikacja (usunięcie zasady z łańcucha) umożliwia hydrolizę DNA w tym miejscu przez piperydynę.

  • Przeprowadza się elektroforezę.

  • Odczytuje się sekwencję.

piperydyna


Podstawowe techniki stosowane w biologii molekularnej

Metoda Sangera opiera się na syntezie

komplementarnej nici DNA.

Metoda Maxama i Gilberta opiera się na

hydrolizie pojedynczej nici DNA.


Podstawowe techniki stosowane w biologii molekularnej

Synteza DNA na stałym podłożu

  • Jednoniciowe cząsteczki DNA można syntetyzować przez kolejne dołączanie konkretnych nukleotydów.

  • Pierwszy nukleotyd zostaje unieruchomiony na stałym podłożu tak, że ma wolną grupę 5’-OH.

  • Nukleotyd, który ma zostać przyłączony ma zablokowane wszystkie grupy, które nie powinny brać udziału w reakcji.


Podstawowe techniki stosowane w biologii molekularnej

DMT

zasada (zablokowana)

b-CE

fosfoamidynian deoksynukleozydu

Nukleotydy do reakcji syntezy oligonukleotydu

Każdy z wyjątkiem pierwszego:

DMT – grupa dimetoksytritylowa

b-CE – grupa b-cyjanoetylowa

Grupa 3’OH: zamiast fosforanu

występuje fosfoamidynian


Podstawowe techniki stosowane w biologii molekularnej

Pierwszy nukleozyd (koniec 3’)

zasada (zablokowana)

przez tę grupę hydroksylową unieruchomiony na złożu


Podstawowe techniki stosowane w biologii molekularnej

Triester fosforanowy (III)

Triester fosforanowy (V)


Podstawowe techniki stosowane w biologii molekularnej

In vivo – synteza DNA przebiega od 5’ do 3’ końca

Syntetyczne oligonukleotydy (in vitro) syntetyzowane są od 3’ do 5’ końca

Jeśli mamy do syntezy oligonukleotyd:

5’-A T T G T C A T T G G C C T A G G A C G -3’

20 18 16 14 12 10 9 8 7 6 5 4 3 2 1

in vitro


Podstawowe techniki stosowane w biologii molekularnej

  • Synteza oligonukleotydów – podsumowanie

  • Pierwszy nukleotyd (właściwie nukleozyd) unieruchomiony (wolna grupa 5’-OH).

  • 2. Dodaje się 3’ fosfoamidynianu konkretnego (zadanego) nukleotydu i zachodzi reakcja. Tworzy się triester fosforanowy (III).

  • Triester fosforanowy (III) utlenia się (+I2) do triestru fosforanowego (V).

  • Odblokowuje się grupę 5’-OH przyłączonego nukleotydu (kwas dichlorooctowy odłącza DMT)

  • PRZEPŁUKUJE SIĘ ZŁOŻE (po co?)

  • Dodaje się kolejny 3’-fosfoamidynian nukleotydu


Podstawowe techniki stosowane w biologii molekularnej

cd.

7. Po zakończeniu syntezy wszystkie grupy blokujące zostają usunięte (NH3) a zsyntetyzowany łańcuch DNA (do ok. 100 nukleotydów) odłączony od złoża.

8. Izoluje się najdłuższy DNA – tylko taki DNA ma kolejno przyłączone wszystkie nukleotydy.


Podstawowe techniki stosowane w biologii molekularnej

Kary Mullis (1/2 nagrody)

"for his invention of the polymerasechain reaction (PCR) method"

Jeszcze jeden Nobel...

The Nobel Prize in Chemistry 1993 - "for contributions to the developments of methods within DNA-based chemistry"

Drugą część nagrody otrzymał wówczas Michael Smith (Kanadyjczyk) za badania nad ukierunkowaną mutagenezą


Podstawowe techniki stosowane w biologii molekularnej

PCR

Łańcuchowa reakcja polimerazy

Łańcuchowa reakcja polimeryzacji

(ang. polymerase chain reaction)

  • Reakcja PCR służy do powielaniałańcucha DNA.

  • Można uzyskać 106 –109 razy więcej określonego

  • DNA niż w materiale wyjściowym.

  • Kluczową rolę odgrywa zastosowanie

  • termostabilnej polimerazy DNA z Thermus

  • aquaticus (polimeraza Taq).

ŹLE – reakcja łańcuchowej polimerazy – ŹLE


Podstawowe techniki stosowane w biologii molekularnej

PCR - cykliczne przeprowadzanie 3 etapów procesu.

Każdy z tych etapów wymaga odpowiedniej temperatury.

Zmiana temperatury musi następować szybko (termocyklery).

1. Denaturacja dsDNA (95°C, 30 s)

2. Przyłączanie starterów

(~54°C, 30 s)

3. Polimeryzacja

(~72°C, 1 min na 1000 pz)


Podstawowe techniki stosowane w biologii molekularnej

Stopień amplifikacji zależy od ilości cykli (n) i w optymalnych warunkach wynosi 2n.

20 cykli: 220 > 1×106;

30 cykli: 230 > 1×109;


Podstawowe techniki stosowane w biologii molekularnej

  • Mieszanina reakcyjna:

  • DNA – matryca

  • Startery (18 – 30 nukleotydów)

  • Deoksyrybonukleotydy

  • Polimeraza Taq

  • Bufor zawierający jony Mg2+

Zwykle prowadzi się 20 - 30 cykli


Podstawowe techniki stosowane w biologii molekularnej

  • Mieszanina reakcyjna:

  • DNA – matryca

  • Startery (18 – 30 nukleotydów)

  • Deoksyrybonukleotydy

  • Polimeraza Taq

  • Bufor zawierający jony Mg2+

Zwykle prowadzi się 20 - 30 cykli


Podstawowe techniki stosowane w biologii molekularnej

Po polsku:

STARTERY !


Podstawowe techniki stosowane w biologii molekularnej

Ilość produktów rośnie wykładniczo (2nrazy).

Ilość produktów dłuższych od oczekiwanych rośnie geometrycznie (2n razy).

Ilość produktów wzrośnie:

Po 20 cyklach =220 > 106 razy

Po 30 cyklach = 230 > 109 razy

Ilość produktów dłuższych od oczekiwanych wzrośnie:

Po 20 cyklach =2 x 20 = 40razy

Po 30 cyklach = 2x 30 = 60 razy

Sprawdź czy te wyliczenia są prawdziwe!!!


Podstawowe techniki stosowane w biologii molekularnej

Znaczenie PCR

  • Laboratoria:

  • - analiza

  • - amplifikacja

  • - tworzenie nowych konstruktów genetycznych

  • Diagnostyka:

  • - niektórych chorób o podłożu genetycznym

  • - mutacji (np. prowadzących do nowotworzenia)

  • - zakażeń bakteryjnych i wirusowych

  • Kryminalistyka – identyfikacja śladów biologicznych


Podstawowe techniki stosowane w biologii molekularnej

Rekombinacja DNA

Umożliwia tworzenie nowych cząsteczek DNA

Po co?

Kilka przykładów

1. Otrzymywanie rekombinowanych białek

2. Badanie aktywności promotorów (konstrukt: promotor + gen reporterowy)

3. Badanie znaczenia białek i ich poszczególnych domen

Paul Berg – Nagroda Nobla (1/2) – 1980 – „for his fundamental studies of the biochemistry of nucleic acids, with particular regard to recombinantDNA"


Podstawowe techniki stosowane w biologii molekularnej

  • Wektory

  • To nośniki fragmentów DNA wykorzystywane w inżynierii genetycznej.

  • Wektorami mogą być plazmidy, wirusy (fagi i wirusy eukariontów), sztuczny chromosom bakteryjny, sztuczny chromosom drożdżowy.

  • Ich podstawowe cechy:

  • zdolne do replikacji

  • możliwe do izolacji niezależnie od

  • genomu gospodarza (np. bakterii)

  • zawierają gen selekcyjny (np. gen

  • oporności na antybiotyk)


Podstawowe techniki stosowane w biologii molekularnej

Pojemność wektorów

  • Plazmidy – sekwencje DNA o długości do kilku tysięcy pz

  • Fagi – sekwencje DNA ok. 10 kpz

  • Kosmidy – 45 kpz

  • Sztuczny chromosom bakteryjny (ang. BAC, bacterial artificial chromosome) – 100 – 350 kpz

  • Sztuczny chromosom drożdżowy

  • (ang. YAC, yeast artificial chromosome) – 100 – 1000 kpz


Podstawowe techniki stosowane w biologii molekularnej

Plazmidy w naturze

  • dwuniciowe, koliste DNA

  • dwa – kilkuset kpz

  • wiele kopii w 1 komórce

  • bakteryjnej (kilka – kilkaset)

  • zawierają 1 lub kilka genów


Podstawowe techniki stosowane w biologii molekularnej

Idea klonowania

gen oporności

na antybiotyk

cDNA kodujący

dowolne białko

restryktazy

ligaza

cDNA = komplementarny DNA


Podstawowe techniki stosowane w biologii molekularnej

Wektory zawierają polilinkery ułatwiające wprowadzanie do nich nowego DNA

Polilinker (ang. polylinker = MCS, multicloning site) to fragment wektora zawierający bardzo dużo różnych miejsc restrykcyjnych.

Polilinker plazmidu pUC18

ok. 60 pz


Podstawowe techniki stosowane w biologii molekularnej

gen oporności

„nowy” gen


Podstawowe techniki stosowane w biologii molekularnej

Mikromacierze DNA

Pozwalają na porównawczą analizę transkryptomów dwóch próbek (np. komórki zdrowe i komórki zmienione nowotworowo albo komórki kontrolne i komórki poddane działaniu jakiegoś hormonu, toksyny itp.).

Pozwalają na równoczesną analizę ekspresji wielu genów: albo wybranych grup genów albo nawet wszystkich genów organizmu.

Na płytkę do analizy (mikromacierz, ang. microarray lub chip) są naniesione specyficzne oligonukleotydy komplementarne do badanych genów.


Podstawowe techniki stosowane w biologii molekularnej

Analiza transkryptomów metodą mikromacierzy


Podstawowe techniki stosowane w biologii molekularnej

  • Analiza transkryptomów metodą mikromacierzy

  • Z próbki kontrolnej i z próbki badanej izoluje się mRNA.

  • Na matrycach mRNA przy użyciu odwrotnej transkryptazy tworzymy zbiory cDNA. W reakcji stosujemy deoksynukleotydy znakowane fluorescencyjnie – próbka kontrolna - barwnik zielony, próbka badana – barwnik czerwony. Im więcej było w komórce danego mRNA tym więcej powstanie znakowanego fluorescencyjnie cDNA.

  • Mikromacierz poddajemy hybrydyzacji ze znakowanymi próbkami – obydwoma równocześnie.


Podstawowe techniki stosowane w biologii molekularnej

  • cd.

  • cDNA z próbki kontrolnej i próbki badanej konkurują o wiązanie do specyficznego oligonukleotydu na mikromacierzy.

  • Analiza mikromacierzy.

  • Jeśli w próbkach kontrolnej i badanej było tyle samo danego cDNA (a więc wyjściowo tyle samo mRNA) to uzyskamy wypadkowo żółtą plamkę w miejscu, gdzie na płytce występował komplementarny oligonukleotyd.

  • Jeśli w próbce badanej jest więcej danego mRNA (np. wskutek stymulacji transkrypcji) – plamka czerwona.

  • Jeśli w próbce badanej jest mniej danego mRNA (np. wskutek zahamowania transkrypcji) – plamka zielona.


Podstawowe techniki stosowane w biologii molekularnej

Przykładowy wynik analizy transkryptomu techniką mikromacierzy DNA

Analiza wpływu niedotlenienia na transkryptom drożdżowy

www.bio.davidson.edu/courses/genomics/chip/chip.html


  • Login