PODSTAWOWE  TECHNIKI
Sponsored Links
This presentation is the property of its rightful owner.
1 / 76

PODSTAWOWE TECHNIKI stosowane w BIOLOGII MOLEKULARNEJ PowerPoint PPT Presentation


  • 246 Views
  • Uploaded on
  • Presentation posted in: General

PODSTAWOWE TECHNIKI stosowane w BIOLOGII MOLEKULARNEJ. ENZYMY RESTRYKCYJNE ENDONUKLEAZY RESTRYKCYJNE RESTRYKTAZY. S ą to enzymy należące do hydrolaz. Stanowią grupę wyodrębnioną spośród D N az. Charakteryzują się tym, że rozpoznają konkretne

Download Presentation

PODSTAWOWE TECHNIKI stosowane w BIOLOGII MOLEKULARNEJ

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


PODSTAWOWE TECHNIKI

stosowane w

BIOLOGII MOLEKULARNEJ


ENZYMY RESTRYKCYJNE

ENDONUKLEAZY RESTRYKCYJNE

RESTRYKTAZY

  • Są to enzymy należące do hydrolaz.

  • Stanowią grupę wyodrębnioną spośród DNaz.

  • Charakteryzują się tym, że rozpoznają konkretne

  • sekwencje w obrębie dwuniciowego DNA i często

  • hydrolizują konkretne wiązanie.


Nagroda Nobla w dziedzinie medycyny/fizjologii

1978

“for the discovery of restriction enzymes and their application to problems of molecular genetics”

Werner Arber, Daniel Nathans, Hamilton O. Smith

Szwajcar

Amerykanie


Enzymy restrykcyjne

  • Zostały odkryte jako enzymy bakteryjne rozkładające fagi wnikające do komórek bakteryjnych.

  • W komórkach bakteryjnych w parze z każdą endonukleazą restrykcyjną występuje metylotransferaza rozpoznająca dokładnie tę samą sekwencję. Metylotransferaza metyluje niektóre zasady w obrębie tej sekwencji i w ten sposób zabezpiecza bakteryjny DNA przed strawieniem przez własny enzym restrykcyjny.

  • Taka para enzymów tworzy system R-M -system restrykcja-modyfikacja (ang. restriction-modification system).


Schemat działania systemu R – M na przykładzie restryktaz typu I

SAM - S-adenozylo-metionina

Curr. Opin. Microbiol.2005, 8:466–472, Tock MR. and Dryden DRF: The biology of restriction and anti-restriction.


Enzymy restrykcyjne

  • Znamy ponad 3000 restryktaz o250 różnych specyficznościach. Izoschizomery to enzymy pochodzące z różnych bakterii, ale wykazujące tę samą specyficzność (np. EcoRI i FunII rozpoznają i hydrolizują w ten sam sposób sekwencję: GAATCC)

  • Restryktazy to enzymy bardzo różnorodne pod względem wielkości i sekwencji aminokwasowej.

  • Na przykład:

  • Enzym Pvu II - 157 aminokwasów (18 kDa)

  • Enzym Cje I – 1250 aminokwasów (145 kDa)


Enzymy restrykcyjne

Nazwa każdego enzymu pochodzi od skrótów nazw bakterii, z których dany enzym wyizolowano + numer (rzymski).


Enzymy restrykcyjne

Wyróżnia się 4 typy enzymów restrykcyjnych: I, II, III, IV

Przede wszystkim enzymy typu II są stosowane w biologii molekularnej, bo tylko one hydrolizują wiązanie w obrębie rozpoznawanej sekwencji.

Rozpoznają sekwencje palindromowe, 4-8 nukleotydowe.

Palindrom: słowo, zdanie, wiersz, które mają to samo znaczenie czytane normalnie i wspak.

Klasyczne: Kobyła ma mały bok

Współczesne: A ma bok cara Barack Obama


Palindromy DNA są nietypowe – musimy uwzględnić to, że DNA jest dwuniciowy

Popija rum As, samuraj i popJulian Tuwim

POPIJARUMAS ----------------------

---------------------- SAMURAJIPOP


Przykładowe sekwencje rozpoznawane przez enzymy restrykcyjne

5’-GGCC-3’

3’-CCGG-5’

5’-TCGCGA-3’

3’-AGCGCT-5’

5’-GCGGCCGC-3’

3’-CGCCGGCG-5’

Enzymy restrykcyjne typu II

są zwykle homodimerami

(Dlaczego?)

http://en.wikipedia.org/wiki/Restriction_enzyme


Odp. prawidłowa:

5’ A T T A A T 3’

3’ T A A T T A 5’

Odp. nieprawidłowe:

5’ A T T T T A 3’

3’ T A A A A T 5’

5’ A T T T T A 3’

3’ A T T T T A 5’

Pytania na egzamin:

1. Uzupełnij sekwencję DNA rozpoznawaną przez typowy enzym restrykcyjny:

5’ A T T ––– 3’

3’ –––––– 5’


2. We fragmencie pojedynczej nici DNA znajdź i podkreśl potencjalne miejsca restrykcyjne:

CAAGCTTGCATGCCCGGGAATTCA

CAAGCTTGCATGCCCGGGAATTCA


5’-CCCGGG-3’

3’-GGGCCC-5’

Enzymy restrykcyjne typu II mogą hydrolizować wiązanie w miejscu osi symetrii rozpoznawanej sekwencji.

Powstają wówczas niekohezyjne (tępe) końce DNA

5’- AGCT-3 ’

3’- TCGA -5’

Sma I Alu I


...lub hydrolizują wiązania poza osią symetrii rozpoznawanej sekwencji.

Powstają wówczaskohezyjne (lepkie)końce DNA


Zarówno przy powstawaniu lepkich jak i tępych końców – wiązanie fosfodiestrowe jest hydrolizowane tak, że na 3’ końcu pozostaje grupa –OH a na 5’ końcu grupa fosforanowa.


Co to jest aktywność enzymatyczna? – definicja

Jak można zdefiniować aktywność enzymu restrykcyjnego?

Definicja musi być na tyle uniwersalna, aby naukowiec mógł porównać preparaty enzymów oferowane przez różne firmy.

Np. Firma X oferuje 500U NotI za 200€

Firma Y oferuje 1000U NotI za 320€

Kupię enzym z firmy Y pod warunkiem, że obie firmy posługują się taką samą definicją U dla enzymów restrykcyjnych.


Jedna jednostka aktywności (U) enzymu restrykcyjnego

to taka jego ilość, która jest potrzebna

do całkowitego strawienia

1 mg DNA faga l*rozpuszczonego w 50 ml

w ciągu 60 min

w warunkach optymalnych dla działania enzymu

(temperatura, bufor)

Wszystkie enzymy typu II wymagają do swojej aktywności jonów Mg2+

Aktywność enzymów restrykcyjnych

*lub inny DNA zawierający dane miejsce restrykcyjne


  • Niektóre enzymy typu II wykazują niższą specyficzność:

  • Np. Hinc II rozpoznaje sekwencje GT[PyPu]AC, a więc:

  • GTTAAC, GTCGAC, GTTGAC, GTCAAC

  • Niektóre enzymy typu II rozpoznają nieciągłe sekwencje palindromowe:

  • Np. Bgl I rozpoznaje sekwencję: GCCNNNNNGGC


Ewolucja niektórych enzymów restrykcyjnych

zachodziła przez horyzontalny transfer genów

Escherichia coli Bacillus amyloli

4 konserwatywne elementy strukturalne


Skąd można wnioskować, że dany gen pojawił się w wyniku horyzontalnego transferu genów?

Jedną z przesłanek może być wynik analizy wykorzystania kodonów, gdyż różne organizmy w różnym stopniu wykorzystują różne kodony.


Ciekawostka:

Nie wszystkie enzymy restrykcyjne rozpoznają sekwencje palindromowe. Np. enzym BbvC I: rozpoznaje sekwencję CCTCAGC

Jak to jest możliwe?

Bo enzym nie występuje jako homo- lecz jako heterodimer.


  • Jak można wykorzystać enzymy restrykcyjne?

  • Manipulacja odcinkami DNA o znanych sekwencjach – możemy w konkretnych miejscach przecinać DNA (a potem dzięki innemu enzymowi, ligazie, łączyć dowolne uzyskane fragmenty) – klonowanie molekularne

  • Możemy identyfikować konkretne sekwencje w obrębie danego DNA – analiza restrykcyjna

Klonowanie molekularne = tworzenie rekombinowanych DNA


Analiza restrykcyjna rejonu promotorowego genu ADAM17 (praca magisterska Magdy Strzeleckiej)

S K H B E/B S

E H

B

S – standard wielkości

K – kontrola, fragment DNA niepoddany trawieniu

H – Hind III

E – Eco RI

B – Bam HI

Negatyw żelu agarozowego wybarwionego EtBr


Analiza restrykcyjna pozwala na wykrywanie niektórych chorób dziedzicznych.

Metoda RFLP

(ang.Restriction Fragment Lenght Polymorphism)

Istotne jest, aby mutacja powodująca chorobę występowała w obrębie sekwencji rozpoznawanej przez enzym restrykcyjny.

Można wykrywać np. pląsawicę Huntingtona, anemię sierpowatą, mukowiscydozę.


Anemia sierpowata

Spowodowana mutacją punktową w genie kodującym łańcuchbhemoglobiny

www.mun.ca/biology/desmid/brian/BIOL2250/Week_Three/ssaRBC.jpg


Przerywamy na chwilę opowieść o RFLP

Jak wykrywać określone sekwencje DNA?

Southern blotting

  • Poddajemy genomowy DNA trawieniu restrykcyjnemu (uzyskujemy bardzo wiele różnych fragmentów).

  • Poddajemy DNA elektroforezie.

  • Denaturujemy (alkaliczna denaturacja).

  • Przenosimy DNA na filtr nitrocelulozowy lub PVDF*.

  • Hybrydyzujemy z sondą wyznakowaną radioizotopowo (jeden z nukleotydów zawiera 32P).

  • Odpłukujemy niespecyficznie związaną sondę.

  • Filtr poddajemy autoradiografii.

technika opracowana przez sir Edwina Southerna *PVDF – polifluorek winylidenu


Po denaturacji i hybrydyzacji:

Southern blotting

Sonda to odcinek dwuniciowego DNA o sekwencji identycznej (a więc i komplemetarnej) do fragmentu sekwencji DNA, którą chcemy wykryć.

wykrywana sekwencja sonda


Wracamy do wykrywania anemii sierpowatej


Mst II

zdrowy

chory

mutacja

  • - zdrowy

  • - chory

  • - chory (heterozygota)

Southern blot

Sonda komplementarna do fragmentu genu kodującego łańcuch b hemoglobiny


Technika Northern blotting

Polega na hybrydyzacji znakowanej sondy z cząsteczkami RNA unieruchomionymi na membranie.

Pozwala na określanie poziomu specyficznych

mRNA w komórkach określonego typu w określonych warunkach (badanie transkryptomu).

Technika Northern blotting będzie dokładnie omówiona na wykładzie z Genetyki molekularnej


Southern blotting - hybrydyzacja DNA-DNA

(od nazwiska Edwina Southerna)

Northern blotting - hybrydyzacja RNA-DNA

Western blotting - wykrywanie konkretnych białek przez przeciwciała

  • Eastern blotting – termin się wykluwa – co się przyjmie?

  • Wykrywanie glikozydów unieruchomionych na membranie (np. po chromatografii) przez przeciwciała

  • Wykrywanie różnych potranslacyjnych modyfikacji białek przez przeciwciała (lub innymi metodami)

  • Wykrywanie białek przez aptamery (oligonukleotydy) znakowane radioizotopowo lub fluorescencyjnie


Sekwencjonowanie DNA

  • Metoda chemiczna Maxama-Gilberta (już raczej nie używana)

  • Metoda enzymatyczna Sangera;

  • (metoda z użyciem dideoksynukleotydów)

Metoda Sangera:

Prowadzimy reakcję syntezy DNA na matrycy DNA w czterech probówkach. Do mieszaniny reakcyjnej dodaje się niewielkiej ilości dideoksynukleotydu (do każdej probówki innego). Wbudowanie ddNTPzatrzymuje reakcję polimeryzacji (brak grupy –OH przy C3’). Powstają odcinki DNA różnej długości, które analizuje się elektroforetycznie.

Walter Gilbert i Frederick Sanger – 1980 – otrzymali po ¼ Nagrody Nobla z chemii

(1/2 otrzymał Paul Berg za rekombinację DNA)


Dideoksynukleotyd

Jeśli w trakcie syntezy do DNA zostanie wbudowany dideoksynukleotyd to synteza zatrzymuje się. Brak grupy -OH przy C-3’ uniemożliwia przyłączenie kolejnego nukleotydu.


Sekwencjonowanie DNA – metoda Sangera

5’-ATGTCAGTCCA-3’


Przykładowe sekwencjonowanie

Prawy panel – typowy obraz „przeciętnego” fragmentu DNA

Lewy panel – sekwencja bogata w nukleotydy G i C. Długi fragment o sekwencji złożonej z powtórzeń GGC.

http://www.cambio.co.uk/l3.php?l1_category_id=3&l2_category_id=93


  • Warianty metody Sangera

  • Zamiast znakowanego deoksynukleotydu można stosować znakowany starter.

  • Zamiast znakowania izotopem (32P lub 35S) można znakować starter znacznikiem fluorescencyjnym.

  • Można również znakować fluorescencyjnie dideoksynukleotydy – każdy innym znacznikiem i reakcję polimeryzacji prowadzić w jednej probówce.


Sekwencjonowanie DNA może być zautomatyzowane

- sekwenatory DNA

Intensywność fluorescencji

Kolejne nukleotydy w sekwencji


Po nałożeniu czterech wykresów uzyskujemy przykładowy następujący obraz:


Porównanie klasycznej metody Sangera z wariantem gdzie dideoksynukleotydy są znakowane różnymi barwnikami fluorescencyjnymi:

http://www.steve.gb.com/images/science/dna_fluorescent_sequencing.png


Sekwencjonowanie genomów

Ciekawostka: największy poznany genom ma Polychaos dubium (ameba) (6,7 x 1011) (informacja stara, niepotwierdzona), a wśród kręgowców - prapłetwiec abisyński (1,3 x 1011).


  • Metoda Maxama i Gilberta

  • Metoda chemiczna.

  • Znakuje się jeden koniec DNA (32P).

  • Rozdziela się DNA do 4 probówek i poddaje działaniu 4 różnych związków chemicznych, które modyfikują konkretne zasady: G, A+G, C, C+T.

  • Ta modyfikacja (usunięcie zasady z łańcucha) umożliwia hydrolizę DNA w tym miejscu przez piperydynę.

  • Przeprowadza się elektroforezę.

  • Odczytuje się sekwencję.

piperydyna


Metoda Sangera opiera się na syntezie

komplementarnej nici DNA.

Metoda Maxama i Gilberta opiera się na

hydrolizie pojedynczej nici DNA.


Synteza DNA na stałym podłożu

  • Jednoniciowe cząsteczki DNA można syntetyzować przez kolejne dołączanie konkretnych nukleotydów.

  • Pierwszy nukleotyd zostaje unieruchomiony na stałym podłożu tak, że ma wolną grupę 5’-OH.

  • Nukleotyd, który ma zostać przyłączony ma zablokowane wszystkie grupy, które nie powinny brać udziału w reakcji.


DMT

zasada (zablokowana)

b-CE

fosfoamidynian deoksynukleozydu

Nukleotydy do reakcji syntezy oligonukleotydu

Każdy z wyjątkiem pierwszego:

DMT – grupa dimetoksytritylowa

b-CE – grupa b-cyjanoetylowa

Grupa 3’OH: zamiast fosforanu

występuje fosfoamidynian


Pierwszy nukleozyd (koniec 3’)

zasada (zablokowana)

przez tę grupę hydroksylową unieruchomiony na złożu


Triester fosforanowy (III)

Triester fosforanowy (V)


In vivo – synteza DNA przebiega od 5’ do 3’ końca

Syntetyczne oligonukleotydy (in vitro) syntetyzowane są od 3’ do 5’ końca

Jeśli mamy do syntezy oligonukleotyd:

5’-A T T G T C A T T G G C C T A G G A C G -3’

20 18 16 14 12 10 9 8 7 6 5 4 3 2 1

in vitro


  • Synteza oligonukleotydów – podsumowanie

  • Pierwszy nukleotyd (właściwie nukleozyd) unieruchomiony (wolna grupa 5’-OH).

  • 2. Dodaje się 3’ fosfoamidynianu konkretnego (zadanego) nukleotydu i zachodzi reakcja. Tworzy się triester fosforanowy (III).

  • Triester fosforanowy (III) utlenia się (+I2) do triestru fosforanowego (V).

  • Odblokowuje się grupę 5’-OH przyłączonego nukleotydu (kwas dichlorooctowy odłącza DMT)

  • PRZEPŁUKUJE SIĘ ZŁOŻE (po co?)

  • Dodaje się kolejny 3’-fosfoamidynian nukleotydu


cd.

7. Po zakończeniu syntezy wszystkie grupy blokujące zostają usunięte (NH3) a zsyntetyzowany łańcuch DNA (do ok. 100 nukleotydów) odłączony od złoża.

8. Izoluje się najdłuższy DNA – tylko taki DNA ma kolejno przyłączone wszystkie nukleotydy.


Kary Mullis (1/2 nagrody)

"for his invention of the polymerasechain reaction (PCR) method"

Jeszcze jeden Nobel...

The Nobel Prize in Chemistry 1993 - "for contributions to the developments of methods within DNA-based chemistry"

Drugą część nagrody otrzymał wówczas Michael Smith (Kanadyjczyk) za badania nad ukierunkowaną mutagenezą


PCR

Łańcuchowa reakcja polimerazy

Łańcuchowa reakcja polimeryzacji

(ang. polymerase chain reaction)

  • Reakcja PCR służy do powielaniałańcucha DNA.

  • Można uzyskać 106 –109 razy więcej określonego

  • DNA niż w materiale wyjściowym.

  • Kluczową rolę odgrywa zastosowanie

  • termostabilnej polimerazy DNA z Thermus

  • aquaticus (polimeraza Taq).

ŹLE – reakcja łańcuchowej polimerazy – ŹLE


PCR - cykliczne przeprowadzanie 3 etapów procesu.

Każdy z tych etapów wymaga odpowiedniej temperatury.

Zmiana temperatury musi następować szybko (termocyklery).

1. Denaturacja dsDNA (95°C, 30 s)

2. Przyłączanie starterów

(~54°C, 30 s)

3. Polimeryzacja

(~72°C, 1 min na 1000 pz)


Stopień amplifikacji zależy od ilości cykli (n) i w optymalnych warunkach wynosi 2n.

20 cykli: 220 > 1×106;

30 cykli: 230 > 1×109;


  • Mieszanina reakcyjna:

  • DNA – matryca

  • Startery (18 – 30 nukleotydów)

  • Deoksyrybonukleotydy

  • Polimeraza Taq

  • Bufor zawierający jony Mg2+

Zwykle prowadzi się 20 - 30 cykli


  • Mieszanina reakcyjna:

  • DNA – matryca

  • Startery (18 – 30 nukleotydów)

  • Deoksyrybonukleotydy

  • Polimeraza Taq

  • Bufor zawierający jony Mg2+

Zwykle prowadzi się 20 - 30 cykli


Po polsku:

STARTERY !


Ilość produktów rośnie wykładniczo (2nrazy).

Ilość produktów dłuższych od oczekiwanych rośnie geometrycznie (2n razy).

Ilość produktów wzrośnie:

Po 20 cyklach =220 > 106 razy

Po 30 cyklach = 230 > 109 razy

Ilość produktów dłuższych od oczekiwanych wzrośnie:

Po 20 cyklach =2 x 20 = 40razy

Po 30 cyklach = 2x 30 = 60 razy

Sprawdź czy te wyliczenia są prawdziwe!!!


Znaczenie PCR

  • Laboratoria:

  • - analiza

  • - amplifikacja

  • - tworzenie nowych konstruktów genetycznych

  • Diagnostyka:

  • - niektórych chorób o podłożu genetycznym

  • - mutacji (np. prowadzących do nowotworzenia)

  • - zakażeń bakteryjnych i wirusowych

  • Kryminalistyka – identyfikacja śladów biologicznych


Rekombinacja DNA

Umożliwia tworzenie nowych cząsteczek DNA

Po co?

Kilka przykładów

1. Otrzymywanie rekombinowanych białek

2. Badanie aktywności promotorów (konstrukt: promotor + gen reporterowy)

3. Badanie znaczenia białek i ich poszczególnych domen

Paul Berg – Nagroda Nobla (1/2) – 1980 – „for his fundamental studies of the biochemistry of nucleic acids, with particular regard to recombinantDNA"


  • Wektory

  • To nośniki fragmentów DNA wykorzystywane w inżynierii genetycznej.

  • Wektorami mogą być plazmidy, wirusy (fagi i wirusy eukariontów), sztuczny chromosom bakteryjny, sztuczny chromosom drożdżowy.

  • Ich podstawowe cechy:

  • zdolne do replikacji

  • możliwe do izolacji niezależnie od

  • genomu gospodarza (np. bakterii)

  • zawierają gen selekcyjny (np. gen

  • oporności na antybiotyk)


Pojemność wektorów

  • Plazmidy – sekwencje DNA o długości do kilku tysięcy pz

  • Fagi – sekwencje DNA ok. 10 kpz

  • Kosmidy – 45 kpz

  • Sztuczny chromosom bakteryjny (ang. BAC, bacterial artificial chromosome) – 100 – 350 kpz

  • Sztuczny chromosom drożdżowy

  • (ang. YAC, yeast artificial chromosome) – 100 – 1000 kpz


Plazmidy w naturze

  • dwuniciowe, koliste DNA

  • dwa – kilkuset kpz

  • wiele kopii w 1 komórce

  • bakteryjnej (kilka – kilkaset)

  • zawierają 1 lub kilka genów


Idea klonowania

gen oporności

na antybiotyk

cDNA kodujący

dowolne białko

restryktazy

ligaza

cDNA = komplementarny DNA


Wektory zawierają polilinkery ułatwiające wprowadzanie do nich nowego DNA

Polilinker (ang. polylinker = MCS, multicloning site) to fragment wektora zawierający bardzo dużo różnych miejsc restrykcyjnych.

Polilinker plazmidu pUC18

ok. 60 pz


gen oporności

„nowy” gen


Mikromacierze DNA

Pozwalają na porównawczą analizę transkryptomów dwóch próbek (np. komórki zdrowe i komórki zmienione nowotworowo albo komórki kontrolne i komórki poddane działaniu jakiegoś hormonu, toksyny itp.).

Pozwalają na równoczesną analizę ekspresji wielu genów: albo wybranych grup genów albo nawet wszystkich genów organizmu.

Na płytkę do analizy (mikromacierz, ang. microarray lub chip) są naniesione specyficzne oligonukleotydy komplementarne do badanych genów.


Analiza transkryptomów metodą mikromacierzy


  • Analiza transkryptomów metodą mikromacierzy

  • Z próbki kontrolnej i z próbki badanej izoluje się mRNA.

  • Na matrycach mRNA przy użyciu odwrotnej transkryptazy tworzymy zbiory cDNA. W reakcji stosujemy deoksynukleotydy znakowane fluorescencyjnie – próbka kontrolna - barwnik zielony, próbka badana – barwnik czerwony. Im więcej było w komórce danego mRNA tym więcej powstanie znakowanego fluorescencyjnie cDNA.

  • Mikromacierz poddajemy hybrydyzacji ze znakowanymi próbkami – obydwoma równocześnie.


  • cd.

  • cDNA z próbki kontrolnej i próbki badanej konkurują o wiązanie do specyficznego oligonukleotydu na mikromacierzy.

  • Analiza mikromacierzy.

  • Jeśli w próbkach kontrolnej i badanej było tyle samo danego cDNA (a więc wyjściowo tyle samo mRNA) to uzyskamy wypadkowo żółtą plamkę w miejscu, gdzie na płytce występował komplementarny oligonukleotyd.

  • Jeśli w próbce badanej jest więcej danego mRNA (np. wskutek stymulacji transkrypcji) – plamka czerwona.

  • Jeśli w próbce badanej jest mniej danego mRNA (np. wskutek zahamowania transkrypcji) – plamka zielona.


Przykładowy wynik analizy transkryptomu techniką mikromacierzy DNA

Analiza wpływu niedotlenienia na transkryptom drożdżowy

www.bio.davidson.edu/courses/genomics/chip/chip.html


  • Login