Supplemental Figure S1
1 / 6

Supplemental Figure S1 - PowerPoint PPT Presentation

  • Uploaded on

Supplemental Figure S1. IgG. Con. Snail1-Flag. DNA-PKcs. IgG. Snail1-Flag. IgG. Supplemental Fig. S2. Non-neoplastic. Case 1. Case 2. Case 3. Case 4. Case 5. DNA-PKcs. Human colon cancer. Snail1. DNA-PKcs. Adenocarcinoma. Snail1. Human lung cancer. DNA-PKcs.

I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
Download Presentation

PowerPoint Slideshow about ' Supplemental Figure S1' - odessa-valenzuela

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.

- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

Supplemental Figure S1








Supplemental Fig. S2


Case 1

Case 2

Case 3

Case 4

Case 5


Human colon cancer





Human lung cancer


Squamouse cell carcinoma


Supplemental Fig. S3


GenBank: AF131208.1

1 atgccgcgctctttcctcgtcaggaagccctccgaccccaatcggaagcctaactacagc


61 gagctgcaggactctaatccagagtttaccttccagcagccctacgaccaggcccacctg


121 ctggcagccatcccacctccggagatcctcaaccccaccgcctcgctgccaatgctcatc


181 tgggactctgtcctggcgccccaagcccagccaattgcctgggcctcccttcggctccag


241 gagagtcccagggtggcagagctgacctccctgtcagatgaggacagtgggaaaggctcc

E S P R V A E L T S L S D E D S G K G S(100)

301 cagccccccagcccaccctcaccggctccttcgtccttctcctctacttcagtctcttcc


361 ttggaggccgaggcctatgctgccttcccaggcttgggccaagtgcccaagcagctggcc


421 cagctctctgaggccaaggatctccaggctcgaaaggcctccaactgcaaatactgcaac


481 aaggaatacctcagcctgggggcgctgaagatgcac


Supplemental Fig. S4















Migration activity (Fold increase)






Normal control

CT26 cells




β -Actin





















E-cadherin promoter activity



Lung weight (%)







































Supplemental Fig. S5






siRNA :



(IR, min)














(IR, min)


/ S107A


/ S107A






















DNA-PK kinase activity

(Fold increase)



















Supplemental Fig. S6


















G2/M phase (%)










(IR, min)




































