Supplemental Figure S1
This presentation is the property of its rightful owner.
Sponsored Links
1 / 6

Supplemental Figure S1 PowerPoint PPT Presentation


  • 42 Views
  • Uploaded on
  • Presentation posted in: General

Supplemental Figure S1. IgG. Con. Snail1-Flag. DNA-PKcs. IgG. Snail1-Flag. IgG. Supplemental Fig. S2. Non-neoplastic. Case 1. Case 2. Case 3. Case 4. Case 5. DNA-PKcs. Human colon cancer. Snail1. DNA-PKcs. Adenocarcinoma. Snail1. Human lung cancer. DNA-PKcs.

Download Presentation

Supplemental Figure S1

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Supplemental figure s1

Supplemental Figure S1

IgG

Con

Snail1-Flag

DNA-PKcs

IgG

Snail1-Flag

IgG


Supplemental figure s1

Supplemental Fig. S2

Non-neoplastic

Case 1

Case 2

Case 3

Case 4

Case 5

DNA-PKcs

Human colon cancer

Snail1

DNA-PKcs

Adenocarcinoma

Snail1

Human lung cancer

DNA-PKcs

Squamouse cell carcinoma

Snail1


Supplemental figure s1

Supplemental Fig. S3

Snail1

GenBank: AF131208.1

1 atgccgcgctctttcctcgtcaggaagccctccgaccccaatcggaagcctaactacagc

M P R S F L V R K P S D P N R K P N Y S

61 gagctgcaggactctaatccagagtttaccttccagcagccctacgaccaggcccacctg

E L Q D S N P E F T F Q Q P Y D Q A H L

121 ctggcagccatcccacctccggagatcctcaaccccaccgcctcgctgccaatgctcatc

L A A I P P P E I L N P T A S L P M L I

181 tgggactctgtcctggcgccccaagcccagccaattgcctgggcctcccttcggctccag

W D S V L A P Q A Q P I A W A S L R L Q

241 gagagtcccagggtggcagagctgacctccctgtcagatgaggacagtgggaaaggctcc

E S P R V A E L T S L S D E D S G K G S(100)

301 cagccccccagcccaccctcaccggctccttcgtccttctcctctacttcagtctcttcc

Q P P S P P S P A P S S F S S T S V S S

361 ttggaggccgaggcctatgctgccttcccaggcttgggccaagtgcccaagcagctggcc

L E A E A Y A A F P G L G Q V P K Q L A

421 cagctctctgaggccaaggatctccaggctcgaaaggcctccaactgcaaatactgcaac

Q L S E A K D L Q A R K A S N C K Y C N

481 aaggaatacctcagcctgggggcgctgaagatgcac

K E Y L S L G A L K M H


Supplemental figure s1

Supplemental Fig. S4

a

*

S100D

Snail1

S100A

*

A549

WT

Con

b

0

5

10

Snail1

Migration activity (Fold increase)

S100A

S100D

Con

WT

Snail1

Normal control

CT26 cells

CT26-WT

CT26-S100A

CT26-S100D

β -Actin

*

S100D

H&E

Snail1

Normal

Con

WT

S100A

S100D

S100A

A549

*

WT

Con

2.5

0.4

0.6

0.8

1

1.2

E-cadherin promoter activity

2

1.5

Lung weight (%)

*

1

0.5

0

WT

Con

S100D

S100A

Normal

CT26


Supplemental figure s1

0

0

0

0

10

10

10

10

30

30

30

30

60

60

60

60

0

0

0

10

10

10

30

30

30

60

60

60

Supplemental Fig. S5

a

NCI-H460

NCI-H460

Con

Snail1

siRNA :

SC

Snail1

(IR, min)

p-p53(Ser15)

p53

g-H2AX

Snail1

b-Actin

c

Snail-Flag

b

WT

S100A

S104A/S107A

Snail1-Flag

Snail1-Flag

(IR, min)

S104A

/ S107A

S104A

/ S107A

pCR3.1

pCR3.1

S100A

p-p53(Ser15)

S100A

WT

WT

p53

Snail1

γ-H2AX

β-Actin

Snail1

NCI-H460

A549

β-Actin

pCR3.1

3

WT

S100A

S104A-107A

1

DNA-PK kinase activity

(Fold increase)

0.5

0

-

-

Snail1

+

+

+

+

+

+

H460

A549


Supplemental figure s1

M059J

0

10

90

120

Supplemental Fig. S6

a

*

60

*

50

40

Death(%)

30

20

10

0

-

+

-

+

Snail1

Si-Snail1

G2/M phase (%)

b

100

80

c

d

60

Death(%)

40

20

(IR, min)

30

60

0

Con

Snail1

p-DNA-PKcs

(Ser2056)

*

M059J

DLD-1

*

DNA-PKcs

Snail1

Snail1/shDNA-PKcs

4500

*

p-GSK3β(Tyr216)

4000

*

3500

*

GSK3β

3000

β-Actin

2500

2000

1500

1000

500

(day)

0

14

19

26

29

33


  • Login