Annotation and Alignment of the Drosophila Genomes
1 / 55

Annotation and Alignment of the Drosophila Genomes Centro de Ciencas Genomicas, May 29, 2006. - PowerPoint PPT Presentation

  • Uploaded on

Annotation and Alignment of the Drosophila Genomes Centro de Ciencas Genomicas, May 29, 2006. Genes or Regulation ?. “10,516 putative orthologs have been identified as a core gene set conserved over 25–55 million years (Myr) since the pseudoobscura / melanogaster divergence”

I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
Download Presentation

PowerPoint Slideshow about ' Annotation and Alignment of the Drosophila Genomes Centro de Ciencas Genomicas, May 29, 2006.' - nura

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.

- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

Annotation and Alignment of the Drosophila Genomes

Centro de Ciencas Genomicas, May 29, 2006.

Genes or regulation
Genes or Regulation?

  • “10,516 putative orthologs have been identified as a core gene set conserved over 25–55 million years (Myr) since the pseudoobscura/melanogaster divergence”

  • “Cis-regulatory sequences are more conserved than random and nearby sequences between the species—but the difference is slight, suggesting that the evolution of cis-regulatory elements is flexible”

Richards et al., Comparative genome sequencing of Drosophila pseudoobscura: Chromosomal, gene, and cis-element evolution, Genome Res., Jan 2005.

BP England, U Heberlein, R Tjian. Purified Drosophila transcription factor, Adh distal factor-1 (Adf-1), binds to sites in several Drosophila promoters and activates transcription, J Biol Chem 1990.

Genes or regulatory elements
Genes annotation with GeneMapper, in press. or Regulatory Elements?

  • “10,516 10,867 putative orthologs have been identified as a core gene set conserved over 25–55 million years (Myr) since the pseudoobscura/melanogaster divergence”

  • “Cis-regulatory sequences are more conserved than random and nearby sequences between the species—but the difference is slight, suggesting that the evolution of cis-regulatory elements is flexible”

Richards et al., Comparative genome sequencing of Drosophila pseudoobscura: Chromosomal, gene, and cis-element evolution, Genome Res., Jan 2005.

Alignment of coding sequence annotation with GeneMapper, in press.







DroYak_1_ GTCGCTCAGCCAGCATTTGCAGAAGTCGCAGAACTTCCGCTCGTTTGACTTCCAGTACTC ****** * ****** ** ** ** ***** **** ** ** ** ** ****** * **

Alignment of non-coding sequence






DroAna_20041206_ AATC-----ACTTAC


DroMoj_20041206_ ----TATTTACTCAC

DroPse_1_ ------TGTACTTAC


DroVir_20041029_ ----TATTTACTCAC


*** **

Alignment of coding sequence annotation with GeneMapper, in press.







DroYak_1_ GTCGCTCAGCCAGCATTTGCAGAAGTCGCAGAACTTCCGCTCGTTTGACTTCCAGTACTC ****** * ****** ** ** ** ***** **** ** ** ** ** ****** * **

Alignment of non-coding sequence

droAna1.2448876 CTGAAGGAATTCTA--TATTAAAG-------------------------------







*** * * * *

droAna1.2448876 AAGATTTCTCATCATTGGTTGAATC---------------------ACTTAC

dm2.chr2L -----------------------------------------TATGGACTCAC

droMoj1.contig_2959 -------------------------AAATATTT--------TATTGACTCAC

dp3.chr4_group3 -----------------------------------------TGT--ACTTAC

droSim1.chr2L -----------------------------------------TATGGACTCAC

droVir1.scaffold_6 ---------------------------------AAATATTTGGTCCACTCAC

droYak1.chr2L -----------------------------------------CATAAACTCAC

*** **












Grun et al. microRNA target predictions across seven Drosophila species and comparison to mammalian targets, PloS Computational Biology, June 2005

Lall et al. A genome wide map of conserved microRNA targets in C. Elegans, Current Biology, February 2006

Example of a conserved microRNA target

Richards et al., Comparative genome sequencing of annotation with GeneMapper, in press.Drosophila pseudoobscura: Chromosomal, gene, and cis-element evolution, Genome Res., Jan 2005.

How is an alignment made from two sequences? annotation with GeneMapper, in press.

Given two sequences of lengths n,m:











dp3.chr4_group3 TGT--ACTTAC




dp3.chr4_group3 TGT--ACTTAC




DroPse_1_ ------TGTACTTAC

Each alignment can be summarized by counting the number of matches (#M), mismatches (#X), gaps (#G), and spaces (#S).


#M=27, #X=18, #G=3, #S=28




dp3.chr4_group3 TGT--ACTTAC




DroPse_1_ ------TGTACTTAC

Each alignment can be summarized by counting the number of matches (#M), mismatches (#X), gaps (#G), and spaces (#S).

2(#M+#X)+#S=112 so #X,#G and #S suffice to specify a summary.

The summary of an alignment is a point in 3 dimensional space.

For example, the two alignments just shown correspond to the points:

(22,3,12) (18,3,28)

The summary of an alignment is a point in 3 dimensional space.

For example, the two alignments just shown correspond to the points:

(22,3,12) (18,3,28)

In the example of our two sequences there are


different alignments.

The summary of an alignment is a point in 3 dimensional space.

For example, the two alignments just shown correspond to the points:

(22,3,12) (18,3,28)

In the example of our two sequences there are


different alignments, but only


different summaries. So we don’t need to plot that many points.

The summary of an alignment is a point in 3 dimensional space.

For example, the two alignments just shown correspond to the points:

(22,3,12) (18,3,28)

In the example of our two sequences there are


different alignments, but only


different summaries. So we don’t need to plot that many points.

But 53890 is still quite a large number. Fortunately, there are only 69 vertices on the convex hull of the 53890 points.

These are the interesting ones, and we can even draw them…

49 #x=24, #S=10, #G=2 space.

There are eight alignments that have this summary.







For the sequences:

the alignment polytope is:



















Consensus at a vertex


The vertices of the polytope have special significance.

Given parameters for a model, e.g. the default parameters for MULTIZ:

M = 100,

X = -100,

S = -30,

G = -400

the summary is the result of maximizing the linear form


over the polytope.

Thus, the vertices of the polytope correspond to optimalalignments.


What is usually done, is that a single set of parameters is specified (M = 100, X = -100, S = -30, G = -400 is a standard default) and then theoptimal vertex is identified using dynamic programming. An alignment optimal for the vertex is then selected. The running time of the algorithm is O(nm) [Needleman-Wunsch, 1970, Smith-Waterman, 1981] and it requires O(n+m) space [Hirschberg 1975] .

Standard scoring schemes are:

Parameters Model

M,X,S Jukes-Cantor with linear gap penalty

M,X,S,GJukes-Cantor with affine gap penalty

M,XTS,XTV,S,GKimura-2 parameter with affine gap penalty

Building CTGCGGGATTAGGGGTCATTAGAGT===------===GCCGAAAAGCGAGTTTATTCTA=TGGACDrosophila whole genome multiple alignments





    (currently no D. erecta)






DroAna_20041206_ AATC-----ACTTAC


DroMoj_20041206_ ----TATTTACTCAC

DroPse_1_ ------TGTACTTAC


DroVir_20041029_ ----TATTTACTCAC


*** **


N. Bray and L. Pachter, MAVID: Constrained ancestral alignment of multiple sequences, Genome Research 14 (2004) p 693--699


droAna1.2448876 CTGAAGGAATTCTA--TATTAAAG-------------------------------







*** * * * *

droAna1.2448876 AAGATTTCTCATCATTGGTTGAATC---------------------ACTTAC

dm2.chr2L -----------------------------------------TATGGACTCAC

droMoj1.contig_2959 -------------------------AAATATTT--------TATTGACTCAC

dp3.chr4_group3 -----------------------------------------TGT--ACTTAC

droSim1.chr2L -----------------------------------------TATGGACTCAC

droVir1.scaffold_6 ---------------------------------AAATATTTGGTCCACTCAC

droYak1.chr2L -----------------------------------------CATAAACTCAC

*** **


Blanchette et al., Aligning multiple sequences with the threaded blockset aligner, Genome Research 14 (2004) p 708--715

One possibly wrong alignment is not enough the history of parametric inference
One (possibly wrong) alignment is not enough: the history of parametric inference

  • 1992: Waterman, M., Eggert, M. & Lander, E.

    • Parametric sequence comparisons, Proc. Natl. Acad. Sci. USA89, 6090-6093

  • 1994: Gusfield, D., Balasubramanian, K. & Naor, D.

    • Parametric optimization of sequence alignment, Algorithmica12, 312-326.

  • 2003: Wang, L., Zhao, J.

    • Parametric alignment of ordered trees, Bioinformatics, 19 2237-2245.

  • 2004: Fernández-Baca, D., Seppäläinen, T. & Slutzki, G.

    • Parametric Multiple Sequence Alignment and Phylogeny Construction, Journal of Discrete Algorithms, 2 271-287.


by Kristian Stevens and Dan Gusfield

Whole Genome Parametric Alignment parametric inferenceColin Dewey, Peter Huggins, Lior Pachter, Bernd Sturmfels and Kevin Woods

  • Mathematics and Computer Science

  • Parametric alignment in higher dimensions.

  • Faster new algorithms.

  • Deeper understanding of alignment polytopes.

  • Biology

  • Whole genome parametric alignment.

  • Biological implications of alignment parameters.

  • Alignment with biology rather than for biology.

Whole Genome Parametric Alignment parametric inferenceColin Dewey, Peter Huggins, Lior Pachter, Bernd Sturmfels and Kevin Woods

  • Mathematics and Computer Science

  • Parametric alignment in higher dimensions.

  • Faster new algorithms.

  • Deeper understanding of alignment polytopes.

  • Biology

  • Whole genome parametric alignment.

  • Biological implications of alignment parameters.









Whole Genome Parametric Alignment parametric inferenceColin Dewey, Peter Huggins, Lior Pachter, Bernd Sturmfels and Kevin Woods

  • Mathematics and Computer Science

  • Parametric alignment in higher dimensions.

  • Faster new algorithms.

  • Deeper understanding of alignment polytopes.

  • Biology

  • Whole genome parametric alignment.

  • Biological implications of alignment parameters.









computational geometry parametric inference

= parametric inference


A Whole Genome Parametric Alignment of

D. Melanogaster and D. Pseudoobscura

  • Divided the genomes into 1,116,792 constrained and 877,982 unconstrained segment pairs.

  • 2d, 3d, 4d, and 5d alignment polytopes were constructed for each of the 877,802 unconstrained segment pairs.

  • Computed the Minkowski sum of the 877,802 2d polytopes.

A Whole Genome Parametric Alignment of parametric inference

D. Melanogaster and D. Pseudoobscura

  • Divided the genomes into 1,116,792 constrained and 877,982 unconstrained segment pairs.

  • This is an orthology map of the two genomes.

  • 2d, 3d, 4d, and 5d alignment polytopes were constructed for each of the 877,802 unconstrained segment pairs.

  • For each segment pair, obtain all possible optimal summaries for all parameters in a Needleman--Wunsch scoring scheme.

  • Computed the Minkowski sum of the 877,802 2d polytopes.

  • There are only 838 optimal alignments of the two Drosophila genomes if the same match, mismatch and gap parameters are used for all the segment pair alignments.

>mel parametric inference







How do we build the polytope for

Alignment polytopes are small
Alignment polytopes are small parametric inference

Theorem: The number of vertices of an alignment polytope for two sequences of length n and m is O((n+m)d(d-1)/(d+1)) where d is the number of free parameters in the scoring scheme.


Parameters Model Vertices

M,X,SJukes-Cantor with linear gap penalty O(n+m)2/3

M,X,S,GJukes-Cantor with affine gap penalty O(n+m)3/2M,XTS,XTV,S,GK2P with affine gap penalty O(n+m)12/5

L. Pachter and B. Sturmfels, Parametric inference for biological sequence analysis, Proceedings of the National Academy of Sciences, Volume 101, Number 46 (2004), p 16138--16143.

L. Pachter and B. Sturmfels, Tropical geometry of statistical models, Proceedings of the National Academy of Sciences, Volume 101, Number 46 (2004), p 16132--16137.

L. Pachter and B. Sturmfels (eds.), Algebraic Statistics for Computational Biology, Cambridge University Press.

Back to Adf1 parametric inference

BP England, U Heberlein, R Tjian. Purified Drosophila transcription factor, Adh distal factor-1 (Adf-1), binds to sites in several Drosophila promoters and activates transcription, J Biol Chem 1990.

Back to adf1
Back to Adf1 parametric inference


pse TGT-----------------GACTGCG

*** ** ***

BLASTZ alignment

Back to adf11
Back to Adf1 parametric inference


pse TGT-----------------GACTGCG

*** ** ***



**** ** * ** * ****** ** *** * **

Back to adf12
Back to Adf1 parametric inference


pse TGT-----------------GACTGCG

*** ** ***



**** ** * ** * ****** ** *** * **



**** * ** *** * ** *****

80.4% parametric inference

85.1% parametric inference

86.5% parametric inference

79.1% parametric inference

Applications parametric inference

  • Conservation of cis-regulatory elements

  • Phylogenetics: branch length estimation

Jukes-Cantor correction:

This is the expected number of mutations per site in an alignment with summary (x,s).

Applications parametric inference

  • Conservation of cis-regulatory elements

  • Phylogenetics: branch length estimation

  • Algebraic Statistics parametric inference

  • -- A language for unifying and developing many of the algorithms for biological sequence analysis --

    • The few inference functions theorem

    • Polytope propagation

    • Phylogenetic tree reconstruction

    • Evolutionary models

    • Maximum likelihood estimation

    • Mutagenic tree models
