Last updated 10/26/11
Download
1 / 62

Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) - PowerPoint PPT Presentation


  • 131 Views
  • Uploaded on

Last updated 10/26/11. http://www.helicosbio.com/Technology/TrueSingleMoleculeSequencing/tabid/64/Default.aspx. Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) ' - nijole


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

Last updated 10/26/11

http://www.helicosbio.com/Technology/TrueSingleMoleculeSequencing/tabid/64/Default.aspx

Like Illumina, but immobilized templates are SS DNA molecules (~200 nt)

Each cycle adds one base,records, and then cleaves the fluorescent group

and washes it away. Several billion single molecule “spots” per slide.



Helicos virtual terminator

Inhibits DNA Pol once incorporated (so 1 base at a time)

Cleavable via the S-S bond (reduce it)

Fluorescent tag

Free 3’ OH never blocked

dU-3’P,5’P

dUTP


Quantification of the yeast transcriptome by single-molecule sequencing

Lipson et al. NATURE BIOTECHNOLOGY 27: 652, 2009

Tail 3’ end with A via terminal transferase, adding dT to terminate

Make cDNA via oligo dT

Add Cy5-labeled special nucleotide tri-Ps + DNA Pol.

Wash.

Record image.

Hybridize to surface-linked oligo dTs

Note: no amplifications or ligations

Add next Cy5-labeled special nucleotide triPs (A) + DNA Pol.

Wash.

Record image.

Cleave dye from incorporated nt.

Wash.



QPCR = quantitative PCR, real time PCR counting

Exponential phase

Non-exponential plateau

phase

CT value

Threshold line

Bio-rad


QPCR (Quantitative PCR) counting

Q-RT-PCR (Quantitative reverse transcription-PCR)

Run 96 samples simultaneously


Some data produced: Distribution of yeast transcripts counting

mRNA

Est. copies/cell: 0.5 5 50 500

TSS position relative to ATG

TSS = transcription start site

t.p.m. = transcripts per million


Complete Genomics counting

(DNA nanoballs)

RCR = rolling circle replication

AcuI: a type IIS restriction enzyme


Rolling circle DNA synthesis ( countingΦ29 polymerase)



Complete Genomics\”CPAL counting

Probes degenerate at all but one position, colored for

the base at that position.

5 probe sets for positions +1 to +5 relative to anchor end

Hybridize, wash, ligate, wash,image.

Second anchor set extends 5 nt(degenerate reach). Repeat10 nt sequenced.

Repeat with anchors on the other side of the adaptor.

Repeat for the other 3 adaptors.

Total 70 nts sequenced(theor. = 80)


Complete Genomics counting

Est. 1 billion spots (reads) per slide

Lower cost

200 human genomes sequenced

Business plan: sell sequencing service, not machines



ZMW = zero mode waveguide counting

10 zl volume seen

(1 zeptoliter = 10-21 L.)

Add template and special phospho nucleotides.

One DNA Pol molecule per ZMW


Cleaved when incorporated counting

Other technologies

Phospho-linked fluorescently-labeled nucleoside triphosphates


Emission counting

Excitation



Pacific Biosciences accuracy.

50,000 ZMWs (Aug., 2011), and density may climb

Long reads (e.g., full molecule analysis for splicing isoform)

Direct RNA sequecning possible.

DNA methylation detectable



Agilent SureSelect RNA Target Enrichment accuracy.

Capture a subgenomic region of interest for economy and speed of sequencing:

E.g.,

the entire exome (all exons w/o introns or intergeneic regions)

hundreds of cancer genes

a particular genomic locus

Alternative: hybridize to a custom microarray.

Agilent


Applications of “deep” sequencing accuracy.

Also: definition and discovery of cis-acting regulatory motifs in DNA and RNA


Detection of methylated C (~all in CpG dinucleotides) accuracy.

cytosine

----CmpG--- >

----CpG-- >

----CmpG--- >

< ---G p Cm---

DS DNA

Na bisulfite

Heat

Na bisulfite

Heat

----CmpG--- >

----UpG-- >

PCR

----TpG-- >

----CpG-- >

<--GpC---

<--ApC---

All NON-methylated Cs changed to T

uracil


DEEP SEQUENCING (Next generation sequencing, High throughput sequencing, Massively parallel sequencing) applications:Human genome re-sequencing (mutations, SNPs, haplotypes, disease associations, personalized medicine)Tumor genome sequencingMicrobial flora sequencing (microbiome)Metagenomic sequencing (without cell culturing)RNA sequencing (RNAseq; gene expression levels, miRNAs, lncRNAs, splicing isoforms)Chromatin structure (ChIP-seq; histone modifications, nucleosome positioning)Epigenetic modifications (DNA CpG methylation and hydroxymethylation)Transcription kinetics (GROseq; nascent RNA, pulse labeled RNA)High throughput genetics (QUEPASA; cis-acting regulatory motif discovery)Drug discovery (bar-coded organic molecule libraries)


Ke et al, and Chasin, Quantitative evaluation of all hexamers as exonic splicing elements. Genome Res. 2011. 21: 1360-1374 ).

Order an equal mixture of all 4 bases at these 6 positions


Rank 6-mer ESRseq score (~ -1 to +1) hexamers as exonic splicing

1 AGAAGA 1.0339

2 GAAGAT 0.9918

3 GACGTC 0.9836

4 GAAGAC 0.9642

5 TCGTCG 0.9517

6 TGAAGA 0.9434

7 CAAGAA 0.9219

8 CGTCGA 0.8853

::

4086 TAGATA -0.8609

4087 AGGTAG -0.8713

4088 CGTCGC 0.8850

4089 CTTAAA -0.8786

4090 CCTTTA -0.8812

4091 GCAAGA 0.8911

4092 TAGTTA -0.8933

4093 TCGCCG 0.9113

4094 CCAGCA -0.8942

4093 CTAGTA -0.9251

4094 TAGTAG -0.9383

4095 TAGGTA -0.9965

4096 CTTTTA -1.0610

Best exonic splicing enhancers

Worst exonic splicing enhancers,

= best exonic splicing silencers


Constitutive exons hexamers as exonic splicing

Alternativexons

Pseudo exons

Composite exon (from ~100,000)


31 hexamers as exonic splicing

Sequence of 36 Quality code

CGCACTGTGCTGGAGCTCCCGGGGTTAACTCTAGAA abU^Vaa`a\aaa]aWaTNZ`aa`Q][TE[UaP_U]

TACACTGTGCTGGAGCTCCCAACGGCAACTCTAGAA a`P^Wa`[`Wa^`X_X_XWVa^NSP]_]S^X_T\X^

CGCACTGTGCTGGAGCTCCCATGGAGAACTCTAGAA aTa`^b``baaaa^aab^YaTQLOHIa`^a``TX]]

TACACTGTGCTGGAGCTCCCCTCCCAAACTCTAGAA I_`aaaa`aaaaaaa_a_^[KZIGIGZ`U`\^P^^`

CGCACTGTGCTGGAGCTCCCAATAGTAACTTTAGAA aY_\abb[T\abaaa`a`bZ[HXXIZa_`_LGMS[`

TATACTGTGCTGGAGCTCCCGACGTAAACTCTAGAA aba]^aa_a]`aa]_]`XWSMFGGIPX[P]X`V_Y^

TACACTGTGCTGGAGCTCCCTGGTAAAACTCTAGAA a_^a^aa`aYaaa_aY`Y_^[I]VY\`]V]R\W]VV

TACACTGTGCTGGAGCTCCCAATAAAAACTCTAGAA XZababa`aZaaaaaYaYXX`baa``\\TaUa\aW`

Variable region

Constant regions

(peculiar to our expt.)

2 nt barcode (TA or CG)

Experiment:

1 1 1 2 2 1+2 2 2 1 2


Next generarion method: hexamers as exonic splicing

Use custom oligo libraries to construct minigene libraries (40,000, up to 60 nt long):

E.g., for saturation mutagenesis to identify all exonic bases contributing to splicing (or transcription or polyadenylation, …..)

Use bar codes to detect sequences missing from the selected molecules

E.g., Nat Biotechnol. 2009 27:1173-5. High-resolution analysis of DNA regulatory elements by synthetic saturation mutagenesis. Patwardhan RP, Lee C, Litvin O, Young DL, Pe'er D, Shendure J.

Long (200-mer) synthetic oligo library


OUTLINE hexamers as exonic splicing OF NEXT LECTURE TOPICSExpression and manipulation of transgenes in the laboratory

33

  • In vitro mutagenesis to isolate variants of your protein/gene with desirable properties

    • Single base mutations

    • Deletions

    • Overlap extension PCR

    • Cassette mutagenesis

  • To study the protein: Express your transgene

    • Usually in E. coli, for speed, economy

    • Expression in eukaryotic hosts

    • Drive it with a promoter/enhancer

    • Purify it via a protein tag

    • Cleave it to get the pure protein

  • Explore protein-protein interaction

  • Co-immunoprecipitation (co-IP) from extracts

  • 2-hybrid formation

  • surface plasmon resonance

  • FRET (Fluorescence resonance energy transfer)

  • Complementation readout


RS1 hexamers as exonic splicing

34

RS2

RS1

RS2

Site-directed mutagenesis by

overlap extension PCR

PCR

fragment

subsequent cloning

in a plasmid

Ligate into similarly cut vector

1

2

Cut with RE 1 and 2


35 hexamers as exonic splicing

Cassette mutagenesis = random mutagenesis but in a limited region:

1) by error-prone PCR

Original sequence coding for, e.g., a transcripiton enhancer region

----------------------------------------------------------------------------------------------------------------------

PCR fragment with high Taqpolymerase and Mn+2 instead of Mg+2 errors

------*--------*--*-**---------------*-----------*--*-------*------------------------*-*-*------------*------------*--

Cut in primer sites and clone upstream of a reporter protein sequence.

Pick colonies

Analyze phenotypes

Sequence


36 hexamers as exonic splicing

Cassette mutagenesis = random mutagenesis but in a limited region:

2) by “doped” synthesisTarget = e.g., an enhancer element

----------------------------------------------------------------------------------------------------------------------

Original enhancer sequence

-*------------------------*-*-*------------*------------*--

------*--------*--*-**---------------*-----------*--*------

Buy 2 doped oligos; anneal

OK for up to ~80 nt.

Clone upstream of a reporter.

Doping = e.g.,

90% G,

3.3% A,

3.3% C,

3.3% T

at each position

Pick colonies

Analyze phenotypes

Sequence


Got this far hexamers as exonic splicing


38 hexamers as exonic splicing

E. coli as a host

  • PROs:Easy, flexible, high tech, fast, cheap; but problems

  • CONs

  • Folding (can misfold)

  • Sorting -> can form inclusion bodies

  • Purification -- endotoxins

  • Modification -- not done (glycosylation, phosphorylation, etc. )

  • Modifications:

  • Glycoproteins

  • Acylation: acetylation, myristoylation

  • Methylation (arg, lys)

  • Phosphorylation (ser, thr, tyr)

  • Sulfation (tyr)

  • Prenylation (farnesyl, geranylgeranyl on cys)

  • Vitamin C-Dependent Modifications (hydroxylation of proline and lysine)

  • Vitamin K-Dependent Modifications (gamma carboxylation of glu)

  • Selenoproteins (seleno-cys tRNA at UGA stop)


39 hexamers as exonic splicing

Some alternative hosts

  • Yeasts (Saccharomyces , Pichia)

  • Insect cells with baculovirus vectors

  • Mammalian cells in culture (later)

  • Whole organisms (mice, goats, corn) (not discussed)

  • In vitro (cell-free), for analysis only(good for radiolabeled proteins)


40 hexamers as exonic splicing

GAPDterm

LEU2

GAPDprom

Ampr

oriE

Yeast Expression Vector (example)

Saccharomyces cerevisiae(baker’s yeast)

2 mu seq:

yeast ori

oriE = bacterial ori

Ampr = bacterial selection

LEU2, e.g. = Leu biosynthesisfor yeast selection

2 micron plasmid

Complementation of an auxotrophy can be used instead of drug-resistance

Your favorite gene(Yfg)

Auxotrophy = state of a mutant in a biosynthetic pathway resulting in a requirement for a nutrient

GAPD = the enzyme glyceraldehyde-3 phosphate dehydrogenase


Yeast genomic integration via homologous recombination

Vector hexamers as exonic splicing DNA

t

p

gfY

Genomic DNA

Genomic DNA

HIS4 mutation-

Yeast - genomic integration via homologous recombination

HIS4

t

p

Yfg

FunctionalHIS4 gene

DefectiveHIS4 gene


Double recombination yeast integration in pichia pastoris

HIS4 hexamers as exonic splicing

Vector DNA

AOX1t

Yfg

AOX1p

3’AOX1

Genomic DNA

AOX1 gene (~ 30% of total protein)

Genomic DNA

Yfg

3’AOX1

AOX1p

AOX1t

HIS4

Double recombination Yeast (integration in Pichia pastoris)

P. pastoris-tight control-methanol induced (AOX1)-large scale production (gram quantities)

Alcohol oxidase gene


PROTEIN-PROTEIN INTERACTIONS hexamers as exonic splicing

Yeast 2-hybrid system to discover proteins that interact with each other

Or to test for interaction based on a hypothesis for a specific protein.

(bait)

?

Y = e.g., a candidate protein being tested for possible interaction with X

Or: Y = e.g., a cDNA library used to discover a protein that interacts with X

?

(prey)

BD = (DNA) binding domain AD = activation domain

http://www.mblab.gla.ac.uk/~maria/Y2H/Y2H.html


No interaction between X and Y: no reporter expression hexamers as exonic splicing

Yes, interaction between X and Y: reporter protein is expressed:

Y = e.g., a cDNA library used to discover a protein that interacts with X

Recover the Y sequence from reporter+ colonies by PCR to idenify protein Y


Fusion library hexamers as exonic splicing

Bait protein is the known target proteinfor whom partners are sought

=“prey”

and/or

Two different assays help, as there are often many false positives.

BD= DNA binding domain; TA = transactiavting domain

http://www.mblab.gla.ac.uk/~maria/Y2H/Y2H.html


3-HYBRID: select for proteins domains that bind a particular RNA sequence

Prey

Bait

Prey could be proteins from a cDNA library


Yeast one-hybrid: particular RNA sequence

Insert a DNA sequence upstream of the selectable or reporter

Transform with candidate DNA-binding proteins (e.g., cDNA library)

fused to an activator domain.

Each T = one copy of a DNA target sequence


Indirect selection using a yeast 3-hybrid system: particular RNA sequencea more efficient glycosynthase enzyme

Directed Evolution of a Glycosynthase via Chemical Complementation

Hening Lin,† Haiyan Tao, and Virginia W. Cornish J. AM. CHEM. SOC. 2004, 126, 15051-15059

Turning a glycosidase into a glyco-synthase

Glycosidase: Glucose-Glucose (e.g., maltose) + H2O  2 Glucose


Indirect selection using the yeast 3-hybrid system particular RNA sequence(one of the hybrid moelcules here is a small molecule)

e.g., from a mutated library of enzyme glycosynthase genes

glucose

Leu2 gene

Leu2 gene

Transform a yeast leucine auxotroph. Provide synthetic chimeric substrate molecules. Select in leucine-free medium.

DHFR = dihydrofolate reductase GR = glucocorticoid receptor (trancription factor )

MTX = methotrexate (enzyme inhibitor of DHFR)

DEX = dexamethasone, a glucocorticoid agonist, binds to GR

AD = activation domain, DBD = DNA binding domain


Selection of improved cellulases via the yeast 2-hybrid system

Survivors are enriched for

cellulase genes that will cleave

cellulose with greater efficiency

(kcat / Km)

Yeast cell

Cellobiose

(disaccharide)

URA-3 (toxic)

cellulase

Directed Evolution of Cellulases via Chemical Complementation. P. Peralta-Yahya, B. T. Carter, H. Lin, H. Tao. V.W. Cornish.

JACS 2008, 130, 17446–17452

x

x

x

x

Library of cellulase mutant genes

(one per cell)


Substrate system


URA-3 = gene for system orotidine phosphate (OMP) decarboxylase

Pathway to pyrimidine nucleotides:

How does the URA-3 system work?

analog

5-fluoroorotic acid

5-Fluoro-OMP

URA-3 decarboxylation

(pyr-4)

5-Fluoro-UMP

Uridine kinase

Exogenousuridine

Thymidylate

Synthetase

inhibition

RNA

Death

Ura3+ is FOA sensitive; ura3- is FOA resistant


Measuring protein-protein interactions system in vitro

X=one protein Y= another protein

Pull-downs:

Binding between defined purified proteins, at least one being purified.

Tag each protein differently.

Examples:

His6-X + HA-Y; Bind to nickel ion column, elute (his), Western with HA Ab

GST-X + HA-Y; Bind to glutathione ion column, elute (glutathione), Western with HA Ab

His6-X + 35S-Y (made in vitro); Bind Ni column, elute (his), gel + autoradiography. No antibody needed.

(HA = influenza virus flu hemagglutinin)

glutathione = Gamma-glutamyl-cysteinyl-glycine.


Example of a result of a pull-down experiment system

Also identfy by MW

(or mass spec)

Total protein: no antibody or Western

(stained with Coomassie blue or silver stain)

Antibody used in Western

Compare pulled down fraction (eluted)with loaded


Western blotting system

To detect the antibody use a secondary antibody against the primary antibody.

The secondary antibody is fusion protein with an enzyme activity (e.g., alkaline phosphatase).

The enzyme activity is detected by its catalysis of a reaction producing a luminescent compound.

http://www.bio.davidson.edu/courses/genomics/method/Westernblot.html


Detection of antibody binding in western blots system

Antibody to protein on membrane

Alkaline phosphatase fusion

Non-luminescent substrate-PO4 =

Y

Y

Luminescent product + PO4=

Secondary antibody-enzyme fusion(e.g., goat anti-rabbit IgG)

Detect by exposing to film

Protein band on membrane


Far western system blotting to detect specific protein-protein interactions.

Use a specific purified protein as a probe instead of the primary antibody

To detect the protein probe use an antibody against it.

Then a secondary antibody, a fusion protein with an enzyme activity.

The enzyme activity is detected by its catalysis of a reaction producing a luminescent compound.

protein

protein

http://www.bio.davidson.edu/courses/genomics/method/Westernblot.html


Expression via in vitro transcription followed by in vitro translation

T7 RNA polymerase

binding site (17-21 nt)

VECTOR

cDNA

….ACCATGG…..

Radioactively

labeled protein

1. Transcription to mRNA via the T7 promoter + T7 polymerase

2. Add to translation system: rabbit reticulocyte lysate

or wheat germ lysate

Or:

E. coli lysate (combined transcription + translation)

All commerically available as kits

Add ATP, GTP, tRNAs, amino acids, label(35S-met),

May need to add RNase (Ca++-dependent) to remove endogenous mRNA In lysate

NOTE: Protein is NOT at all pure (100s of lysate proteins present), just “radio-pure”


A translation

A

A

X

X

X

X

X

X

X

X

Y

Y

Y

Y

C

Y

D

D

B

D

C

B

C

Y

Y

Y

B

A

A

A

A

A

A

A

A

A

A

A

A

A

A

A

  • Co-immunoprecipitation

  • Most times not true precipitation, which requires about equivalent concentrations of antigen and antibody

  • Use protein A immobilized on beads (e.g., agarose beads)

  • Protein A is from Staphylococcus aureus: binds tightly to Immunoglobulin G (IgG) from many species.

Does X interact with Y in the cell or in vitro?

incubate

+

+ anti-X IgG

Or cell extract

+ Protein A

+

Wash by centrifugation (or magnet)

Elute with SDS

Detect X, Y in eluate by Western blotting


Surface plasmon resonance (SPR) translation

The binding events are monitored in real-time and it is not necessary to label the interacting biomolecules.

glass plate

http://home.hccnet.nl/ja.marquart/BasicSPR/BasicSpr01.htm


Expression in mammalian cells translation

Lab examples:

HEK293 Human embyonic kidney (high transfection efficiency)

HeLa Human cervical carcinoma (historical, low RNase)

CHO Chinese hamster ovary (hardy, diploid DNA content, mutants)

Cos Monkey cells with SV40 replication proteins (-> high transgene copies)

3T3 Mouse or human exhibiting ~regulated (normal-like) growth

+ various others, many differentiated to different degrees, e.g.:

BHK Baby hamster kidey

HepG2 Human hepatoma

GH3 Rat pituitary cells

PC12 Mouse neuronal-like tumor cells

MCF7 Human breast cancer

HT1080 Human with near diploid karyotype

IPS induced pluripotent stem cells

and:

Primary cells cultured with a limited lifetime.

E.g., MEF = mouse embryonic fibroblasts, HDF = Human diploid fibroblasts

Common in industry:

NS1 Mabs Mouse plasma cell tumor cells

Vero vaccines African greem monkey cells

CHO Mabs, other therapeutic proteins Chinese hamster ovary cells

PER6 Mabs, other therapeutic proteins Human retinal cells


ad