Barcoding the Birds of Argentina
This presentation is the property of its rightful owner.
Sponsored Links
1 / 27

Barcoding the Birds of Argentina PowerPoint PPT Presentation


  • 59 Views
  • Uploaded on
  • Presentation posted in: General

Barcoding the Birds of Argentina. Saltator aurantiirostris. Saltator similis. Saltator caerulescens 1 Saltator caerulescens 2. Darío A. Lijtmaer 1 and Kevin C. R. Kerr 2 1 Museo Argentino de Ciencias Naturales “B. Rivadavia”, Argentina 2 University of Guelph, Canada. Birds of

Download Presentation

Barcoding the Birds of Argentina

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Barcoding the birds of argentina

Barcoding the Birds of Argentina

Saltator aurantiirostris

Saltator similis

Saltator caerulescens 1

Saltator caerulescens 2

Darío A. Lijtmaer1 and Kevin C. R. Kerr2

1Museo Argentino de Ciencias Naturales “B. Rivadavia”, Argentina

2University of Guelph, Canada


Barcoding the birds of argentina

Birds

of

Argentina

Almost 1000 species

25% of the birds of the Neotropics

About 10% of the birds of the world


Barcoding the birds of argentina

Birds

of

Argentina

  • Representative of the southern cone of South America:

  • 100% of the birds of Uruguay

  • 95% of the birds of Paraguay

  • 85% of the birds of Chile

  • 52% of the birds of Bolivia

  • 94% of the birds of southern Brazil (Rio Grande do Sul)


Barcoding the birds of argentina

Birds

of

Argentina


Barcoding the birds of argentina

Birds

of

Argentina


Barcoding the birds of argentina

Barcoding the Birds of Argentina

Main objective: to obtain the barcodes of all the species of birds of Argentina by the end of 2008

  • Additional objectives:

  • Comparison of patterns of COI variation between:

  • Cold temperate and subtropical areas

  • Northern and southern hemispheres

  • High altitude and lowland areas


Barcoding the birds of argentina

2006

900 samples loaned to Guelph, lab training

2007

420 samples loaned to Guelph

2003

Tissue

collection

started

2004

MACN

signed the MOC

2006

Lounsbery Foundation grant

2005

project started

2006

Field trip training

Barcoding the Birds of Argentina

2003

2004

2005

2006

2007

2008


Barcoding the birds of argentina

Barcoding the Birds of Argentina

Collecting trips

Tissues and vouchers stored at MACN

AATCGATCCTAGTACTCGATCCTAGTACCA

Sub-samples loaned to Guelph


Barcoding the birds of argentina

Barcoding the Birds of Argentina

Collecting trips

Tissues and vouchers stored at MACN

Samples processed at MACN (extraction and amplification)

AATCGATCCTAGTACTCGATCCTAGTACCA

Amplified DNA loaned to Guelph


Barcoding the birds of argentina

Preliminary results

Barcodes were obtained for 809 individuals and 316 species (1/3 of the species of Argentina)


Barcoding the birds of argentina

0.23% in North America

7.93% in North America (260 species)

Preliminary results

The COI sequence was never shared between species

COI sequences were obtained for more than one individual in 233 species (74% of the species barcoded). Mean intraspecific distance was 0.28%

Mean interspecific distance between species of the same genus was 7.95% (28-fold higher than mean intraspecific distance)


Barcoding the birds of argentina

Preliminary results

In only 1 pair of species COI distances were not smaller within species than between species

Muscisaxicola flavinucha

Muscisaxicola cinerea

Intraspecific distances: 0 - 0.46%

Interspecific distances: 0.43 - 0.46%


Barcoding the birds of argentina

For 99% of the species barcoded so far, an individual could be correctly identified based on its COI sequence

Preliminary results

In only 1 pair of species COI distances were not smaller within species than between species

In 99% of the species COI clusters did not overlap with those of other species


Barcoding the birds of argentina

Preliminary results

4 other cases in which interspecific distances were lower than 1%

Veniliornis frontalis and Veniliornis passerinus

Distance: 0.29%

Veniliornis passerinus

Veniliornis frontalis


Barcoding the birds of argentina

Preliminary results

4 other cases in which interspecific distances were lower than 1%

Anas puna and Anas versicolor

Distance: 0.43 - 0.72%

Anas cyanoptera 1 Anas cyanoptera 2

Anas platalea

Anas puna 1 Anas puna 2

Anas versicolor 1

Anas versicolor 2


Barcoding the birds of argentina

Preliminary results

4 other cases in which interspecific distances were lower than 1%

Anas puna and Anas versicolor

Distance: 0.43 - 0.72%

Carduelis crassirostris and Carduelis atrata

Distance: 0.43 - 0.58%

Mimus triurus and Mimus dorsalis

Distance: 0.72 - 0.87%


Barcoding the birds of argentina

Preliminary results

3 species in which intraspecific distances were higher than 2.8% (10 times mean intraspecific distance)

Troglodytes aedon

(up to 3.25%)

Cistothorus platensis

(up to 4.95%)

Leptasthenura aegithaloides

(up to 3.72%)


Barcoding the birds of argentina

Preliminary results

In conclusion, our preliminary results suggest that:

  • The COI sequence can be efficiently used for identification purposes

2) At the same time, the use of the COI can be useful to flag interesting species or groups of species

3) Patterns of COI divergence appear to be similar to those obtained for North American birds


Barcoding the birds of argentina

2500

2000

1500

1000

500

0

500

400

300

200

100

0

Project

started

Project

started

DIC

2003

DIC

2004

DIC

2005

DIC

2006

DIC

2003

DIC

2004

DIC

2005

DIC

2006

Additional benefits of the project

1) Tissue Collection

Specimens

Species

The project boosted the MACN tissue collection: three times increase in specimens and about two and a half times increase in species during last year.


Barcoding the birds of argentina

Additional advantages of the project

2) Skins and skeletons

All tissue samples collected have associated vouchers

3) Certification of the identity of specimens in the collection

Barcodes can be used to verify the correct identification of tissue samples, skins and skeletons


Barcoding the birds of argentina

Additional advantages of the project

4) Control of legal and illegal trade of bird species

Podiceps gallardoi


Barcoding the birds of argentina

The future

  • Currently: 33% of the species of Argentina barcoded


Barcoding the birds of argentina

The future

  • Currently: 33% of the species of Argentina barcoded

  • Mid 2007: 50% of the species barcoded


Barcoding the birds of argentina

The future

  • Currently: 33% of the species of Argentina barcoded

  • Mid 2007: 50% of the species barcoded

  • End of 2007: 70% of the species barcoded


Barcoding the birds of argentina

The future

  • Currently: 33% of the species of Argentina barcoded

  • Mid 2007: 50% of the species barcoded

  • End of 2007: 70% of the species barcoded

  • End of 2008: 100% of the species barcoded


Barcoding the birds of argentina

The future

  • Currently: 33% of the species of Argentina barcoded

  • Mid 2007: 50% of the species barcoded

  • End of 2007: 70% of the species barcoded

  • End of 2008: 100% of the species barcoded

  • Integration of our results with those of other studies undertaken in the Neotropics and in other regions of the world.


Barcoding the birds of argentina

Thank you


  • Login