Arthur gruber
Sponsored Links
This presentation is the property of its rightful owner.
1 / 46

The biological meaning of pairwise alignments PowerPoint PPT Presentation

  • Uploaded on
  • Presentation posted in: General

Arthur Gruber. The biological meaning of pairwise alignments. Instituto de Ciências Biomédicas Universidade de São Paulo. AG-ICB-USP. What is a pairwise alignment?. Comparison of 2 sequences – nucleotide or protein sequences

Download Presentation

The biological meaning of pairwise alignments

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.

- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript

Arthur Gruber

The biological meaning of pairwise alignments

Instituto de Ciências Biomédicas Universidade de São Paulo


What is a pairwise alignment?

  • Comparison of 2 sequences – nucleotide or protein sequences

  • We can compare a sequence to an entire database of sequences – one pairwise alignment at a time

  • Different types of alignments – global and local alignment

  • Different algorithms – Needleman-Wunsch, Smith-Waterman, FastA, BLAST


Pairwise alignment

  • Output: alignment of similar blocks or whole sequences

gi|3323386|gb|U85705.1|IFU85705 Isospora felis 28S large subunit ribosomal RNA gene, complete sequence Length = 3227 Score = 218 bits (110), Expect = 2e-54 Identities = 146/158 (92%) Strand = Plus / Minus

Query: 3 cacttttaactctctttccaaagtccttttcatctttccttcacagtacttgttcactat 62

||||||||||||||||||||||| |||||||||||||| |||| ||||||||| ||||

Sbjct: 386 cacttttaactctctttccaaagaacttttcatctttccctcacggtacttgtttgctat 327

Query: 63 cggtctcacgccaatatttagctttacgtgaaacttatcacacattttgcgctcaaatcc 122

||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||

Sbjct: 326 cggtctcgcgccaatatttagctttatgtgaaacttatcacacattttgcgctcaaatcc 267

Query: 123 caatgaacgcgactcaataaaagcgcaccgtacgtgga 160

| ||||||||||||| ||||| ||| ||||||||||||

Sbjct: 266 cgatgaacgcgactctataaaggcgtaccgtacgtgga 229


Some applications of pairwise alignments

  • Annotation – description of the characteristics of a sequence

  • Function ascribing – similar sequences MAY share similar functions

  • Identification of structural domains – similar sequences MAY share similar structures

  • Identification of protein domains – defines protein architecture

  • Phylogenetic inference – identification of similar sequences that MAY have a common ancestry


Some applications of pairwise alignments

  • Identification of contaminant sequences in a sequencing project – query sequence x databases (bacterial, ribosomal, mitochondrial, etc.)

  • Identification of vector sequences in sequencing reads – alignment and masking


Identity, similarity, homology

  • Identity – refers to nucleotide or amino acid residues that are identical

  • Similarity - measurable quantity: percentage of identities between two sequences, percentage of similar amino acid residues (conserved along the evolution).

  • Homology – based on a evolutionary conclusion that implies that two sequences has a common ancestral sequence. They are said to share the same evolutionary history. Homology is not quantitative. Two sequences can be or not to be homologous.


Identity, similarity, homology

  • A high degree of similarity between two sequences MAY suggest that they share a common evolutionary history. Other analyses and experimental work should be done to validate such hypothesis


Contaminant removal

Other organisms and/or cells – co-purification

Bacterial DNA - E. coli used as the host cell

Human – contamination during manipulation

Other genomes being manipulated in the lab – cross-contamination

Libraries can be contaminated by different sources

Genomic libraries:


Contaminant removal

All sources already mentioned

Ribosomal RNA – co-purification with the polyA fraction

Organelle transcripts – mitochondrion, plastid

Libraries can be contaminated by different sources

EST libraries:


Vector masking

A typical read contains sequence stretches that are not originally part of the insert


Sequencing reaction






Vector masking

“X” bases will not be taken into account by assembly/clustering programs

Masking consists in a substitution of bases that are not part of the insert by Xs














Aligning Two Sequences

Human Hemoglobin (HH):


Sperm Whale Myoglobin (SWM):




||| | | || | |


Gap Weight: 12

Length Weight: 4

Gaps: 0

Percent Similarity: 40.000

Percent Identity: 36.000

Matrix: blosum62

Aligning Two Sequences


Gap Insertion/Deletion




-gap insertion/deletion

Gap Weight: 4

Length Weight: 1

Gaps: 2

Percent Similarity: 54.167

Percent Identity: 45.833





|||| | || || |


The score of the alignment is:

Matrix valueat (V,V) + (L,L) + (S,S) + (P,E) + …(penalty forgap insertion/deletion)*gaps(penalty forgap extension)*(total length of all gaps)


Scoring System

  • Identity:An objective and quite well defined measureCount thenumber of identical matches, divide bylength of aligned region

  • Similarity:A less well defined measure

    CategoryAmino acid

    Acids and AmidesAsp (D) Glu(E) Asn (N) Gln (Q)

    BasicHis (H) Lys (K) Arg (R)

    AromaticPhe (F) Tyr (Y) Trp (W)

    HydrophilicAla (A) Cys (C) Gly (G) Pro (P) Ser (S) Thr (T)

    HydrophobicIle (I) Leu (L) Met (M) Val (V)


Scoring system

Rates of amino acid substitution are not uniform

Some amino acids are more conserved than others (e.g. C, H, W compared to A, L, I)

Some substitutions are more common than others

(e.g. A I, A L compared to D L)

Conclusion: there are evolutionary pressures that probably reflect structural and functional constraints

Scoring matrices – matrices that are used for scoring amino acid substitutions in pairwise alignments

They reflect substitution rates that are originated by evolutionary events


Amino acids - chemical relationships


































  • Stands for Point Accepted Mutation

  • Dayhoff Matrix, 1978

  • A series ofmatricesdescribing the extent to which two amino acids have been interchanged inevolution

  • Very similar sequences werealigned, phylogenetic trees were built, and ancestral sequences were reconstructed

  • Out of these alignments, thefrequency of substitutionbetween each pair of amino acids was calculated. Using this information,PAM matriceswere built (PAM1 i.e. one accepted point mutation per 100 amino acids).


PAM250 - amino acid substitution matrix




A 2 0 -2 0 0 -4 1 -1 -1 -1 -2 -1 0 1 0 -2 1 1 0 -6

B 0 2 -4 3 2 -5 0 1 -2 1 -3 -2 2 -1 1 -1 0 0 -2 -5

C -2 -4 12 -5 -5 -4 -3 -3 -2 -5 -6 -5 -4 -3 -5 -4 0 -2 -2 -8

D 0 3 -5 4 3 -6 1 1 -2 0 -4 -3 2 -1 2 -1 0 0 -2 -7

E 0 2 -5 3 4 -5 0 1 -2 0 -3 -2 1 -1 2 -1 0 0 -2 -7

F -4 -5 -4 -6 -5 9 -5 -2 1 -5 2 0 -4 -5 -5 -4 -3 -3 -1 0

G 1 0 -3 1 0 -5 5 -2 -3 -2 -4 -3 0 -1 -1 -3 1 0 -1 -7

H -1 1 -3 1 1 -2 -2 6 -2 0 -2 -2 2 0 3 2 -1 -1 -2 -3

I -1 -2 -2 -2 -2 1 -3 -2 5 -2 2 2 -2 -2 -2 -2 -1 0 4 -5

K -1 1 -5 0 0 -5 -2 0 -2 5 -3 0 1 -1 1 3 0 0 -2 -3

L -2 -3 -6 -4 -3 2 -4 -2 2 -3 6 4 -3 -3 -2 -3 -3 -2 2 -2

M -1 -2 -5 -3 -2 0 -3 -2 2 0 4 6 -2 -2 -1 0 -2 -1 2 -4

N 0 2 -4 2 1 -4 0 2 -2 1 -3 -2 2 -1 1 0 1 0 -2 -4

P 1 -1 -3 -1 -1 -5 -1 0 -2 -1 -3 -2 -1 6 0 0 1 0 -1 -6

Q 0 1 -5 2 2 -5 -1 3 -2 1 -2 -1 1 0 4 1 -1 -1 -2 -5

R -2 -1 -4 -1 -1 -4 -3 2 -2 3 -3 0 0 0 1 6 0 -1 -2 2

S 1 0 0 0 0 -3 1 -1 -1 0 -3 -2 1 1 -1 0 2 1 -1 -2

T 1 0 -2 0 0 -3 0 -1 0 0 -2 -1 0 0 -1 -1 1 3 0 -5

V 0 -2 -2 -2 -2 -1 -1 -2 4 -2 2 2 -2 -1 -2 -2 -1 0 4 -6

W -6 -5 -8 -7 -7 0 -7 -3 -5 -3 -2 -4 -4 -6 -5 2 -2 -5 -6 17



Stands forBlocksSubstitution Matrices

Henikoff and Henikoff, 1992

A series of matrices describing the extent to whichtwo amino acids are interchangeablein conserved structures

Built by extracting replacement information from the alignments in the BLOCKS database.



The number in the series (BLOSUM62) represents the thresholdpercentsimilarity between sequences, for considering them in the calculation.

For example,BLOSUM62is derived from an alignment of sequences that share62% similarity, BLOSUM45 is based on 45% sequence similarity in aligned sequences


BLOSUM62 - amino acid substitution matrix

Reference: Henikoff, S. and Henikoff, J. G. (1992). Amino acid substitution matrices from protein blocks. Proc. Natl. Acad. Sci. USA 89: 10915-10919.

A R N D C Q E G H I L K M F P S T W Y V B Z X *A 4 -1 -2 -2 0 -1 -1 0 -2 -1 -1 -1 -1 -2 -1 1 0 -3 -2 0 -2 -1 0 -4 R -1 5 0 -2 -3 1 0 -2 0 -3 -2 2 -1 -3 -2 -1 -1 -3 -2 -3 -1 0 -1 -4 N -2 0 6 1 -3 0 0 0 1 -3 -3 0 -2 -3 -2 1 0 -4 -2 -3 3 0 -1 -4 D -2 -2 1 6 -3 0 2 -1 -1 -3 -4 -1 -3 -3 -1 0 -1 -4 -3 -3 4 1 -1 -4 C 0 -3 -3 -3 9 -3 -4 -3 -3 -1 -1 -3 -1 -2 -3 -1 -1 -2 -2 -1 -3 -3 -2 -4 Q -1 1 0 0 -3 5 2 -2 0 -3 -2 1 0 -3 -1 0 -1 -2 -1 -2 0 3 -1 -4 E -1 0 0 2 -4 2 5 -2 0 -3 -3 1 -2 -3 -1 0 -1 -3 -2 -2 1 4 -1 -4 G 0 -2 0 -1 -3 -2 -2 6 -2 -4 -4 -2 -3 -3 -2 0 -2 -2 -3 -3 -1 -2 -1 -4 H -2 0 1 -1 -3 0 0 -2 8 -3 -3 -1 -2 -1 -2 -1 -2 -2 2 -3 0 0 -1 -4 I -1 -3 -3 -3 -1 -3 -3 -4 -3 4 2 -3 1 0 -3 -2 -1 -3 -1 3 -3 -3 -1 -4 L -1 -2 -3 -4 -1 -2 -3 -4 -3 2 4 -2 2 0 -3 -2 -1 -2 -1 1 -4 -3 -1 -4 K -1 2 0 -1 -3 1 1 -2 -1 -3 -2 5 -1 -3 -1 0 -1 -3 -2 -2 0 1 -1 -4 M -1 -1 -2 -3 -1 0 -2 -3 -2 1 2 -1 5 0 -2 -1 -1 -1 -1 1 -3 -1 -1 -4 F -2 -3 -3 -3 -2 -3 -3 -3 -1 0 0 -3 0 6 -4 -2 -2 1 3 -1 -3 -3 -1 -4 P -1 -2 -2 -1 -3 -1 -1 -2 -2 -3 -3 -1 -2 -4 7 -1 -1 -4 -3 -2 -2 -1 -2 -4 S 1 -1 1 0 -1 0 0 0 -1 -2 -2 0 -1 -2 -1 4 1 -3 -2 -2 0 0 0 -4 T 0 -1 0 -1 -1 -1 -1 -2 -2 -1 -1 -1 -1 -2 -1 1 5 -2 -2 0 -1 -1 0 -4 W -3 -3 -4 -4 -2 -2 -3 -2 -2 -3 -2 -3 -1 1 -4 -3 -2 11 2 -3 -4 -3 -2 -4 Y -2 -2 -2 -3 -2 -1 -2 -3 2 -1 -1 -2 -1 3 -3 -2 -2 2 7 -1 -3 -2 -1 -4 V 0 -3 -3 -3 -1 -2 -2 -3 -3 3 1 -2 1 -1 -2 -2 0 -3 -1 4 -3 -2 -1 -4 B -2 -1 3 4 -3 0 1 -1 0 -3 -4 0 -3 -3 -2 0 -1 -4 -3 -3 4 1 -1 -4 Z -1 0 0 1 -3 3 4 -2 0 -3 -3 1 -1 -3 -1 0 -1 -3 -2 -2 1 4 -1 -4 X 0 -1 -1 -1 -2 -1 -1 -1 -1 -1 -1 -1 -1 -1 -2 0 0 -2 -1 -1 -1 -1 -1 -4 * -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 -4 1



Lower PAMsandhigher Blosumsfind short local alignment of highly similar sequences

Higher PAMsand lower Blosumsfind longer weaker local alignment

No single matrix answers all questions


BLAST – Basic Local Alignment Search Tool

  • Algorithm first described in 1990

    Altschul, S.F., Gish, W., Miller, W., Myers, E.W. & Lipman, D.J. (1990) "Basic local alignment search tool." J. Mol. Biol.215:403-410.

  • And improved in 1997

    Altschul, S.F., Madden, T.L., Schäffer, A.A., Zhang, J., Zhang, Z., Miller, W. & Lipman, D.J.(1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res.25: 3389-3402.


Blast search – four components

  • Search purpose/goal

  • Program

  • Query sequence

  • Database


BLAST – search purpose/goal

  • What is the biological question? Examples:

    • Which proteins of the database are similar to my protein sequence?

    • Which proteins of the database are similar to the conceptual translation of my DNA sequence?

    • Which nucleotide sequences in the database are similar to my nucleotide sequence?

    • Which proteins coded by the conceptual translation of the database sequences are similar to my protein sequence?

    • Which proteins coded by the conceptual translation of the database sequences are similar to the conceptual translation of my DNA sequence?


BLAST – search purpose/goal

  • Which proteins of the database are similar to my protein sequence?

    • I have sequenced a gene and derived the protein sequence by concetpual translation. Alternatively, I obtained the protein sequence directly. I am now interested to find out its possible fnction.

    • Using a similarity search, I can find protein sequences in databases that are similar to mine: orthologs and paralogs.

    • BLASTP – protein query x protein database


BLAST - search purpose/goal

  • Which proteins of the database are similar to the conceptual translation of my DNA sequence?

    • I have sequenced an EST (expressed sequence tag) that contains a protein coding region.

    • I am interested to find out which proteins of the database are similar to the conceptual translation of my nucleic acid sequence.

    • BLASTX – nucleotide (translated) query x protein database


BLAST – search purpose/goal

  • Which nucleotide sequences of the database are similar to my DNA sequence?

    • I have sequenced a DNA fragment.

    • I am interested to find out which DNA sequences of the database are similar to my nucleic acid sequence.

    • BLASTN – nucleotide query x nucleotide database


BLAST - search purpose/goal

  • Which proteins translated from a nucleic acid database are similar to the conceptual translation of my DNA sequence?

    • I have sequenced an EST (expressed sequence tag) that contains a protein coding region.

    • I am interested to find out which ESTs of other organisms may be coding for homologous proteins.

    • TBLASTX – nucleotide (translated) query x nucleotide (translated) database


BLAST – search purpose/goal

  • Which proteins coded by the conceptual translation of the database sequences are similar to my protein sequence?

    • I have a protein sequence on hands and am interested to find out which genes of other organisms may be coding for homologous proteins.

    • TBLASTN – protein query x nucleotide (translated) database


BLAST - programs

  • BLASTP – protein query x protein database

  • BLASTN – nucleotide query x nucleotide database

  • BLASTX – nucleotide (translated) query x protein database

  • TBLASTN – protein query x nucleotide (translated) database

  • TBLASTX – nucleotide query (translated) x nucleotide (translated) database


FastA format

The first line begins with the symbol '>' followed by the name of the sequence

The sequence is on the remaining lines.

The sequence must not contain blanks.

The sequence could be in upper or lower case.

Below is an example sequence in FASTA format:\

>DNA sequence





BLAST – query sequence


BLAST – database

  • Nucleotide databases

    • nr, refseq, est_human, est_mouse, est_others, wgs, etc.

  • Protein databases – nr, Swiss-Prot, refseq, etc.












Blast programs

  • PSI-BLAST – Position-Specific Iterated BLAST program - performs an iterative search in which sequences found in one round of searching are used to build a score model for the next round of searching. In PSI-BLAST the algorithm is not tied to a specific score matrix.

  • PHI-BLAST – Pattern-Hit Initiated BLAST -a search program that combines matching of regular expressions with local alignments surrounding the match.

  • MEGABLAST – uses the greedy algorithm for nucleotide sequence alignment search - it can be up to 10 times faster than more common sequence similarity programs and handles much longer DNA sequences than the blastn program


  • Login