1 / 57

GENE REGULATION

GENE REGULATION. OXYTOCIN. The following gene is from mRNA that has been copied with reverse transcriptase to produce cDNA Sequence provided is from the coding strand. 1 accagtcacg gaccctggac ccagcgcacc cgcaccatgg ccggccccag cctcgcttgc

mwarner
Download Presentation

GENE REGULATION

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. GENE REGULATION

  2. OXYTOCIN • The following gene is from mRNA that has been copied with reverse transcriptase to produce cDNA • Sequence provided is from the coding strand

  3. 1 accagtcacg gaccctggac ccagcgcacc cgcaccatgg ccggccccag cctcgcttgc 61 tgtctgctcg gcctcctggc gctgacctcc gcctgctaca tccagaactg ccccctggga 121 ggcaagaggg ccgcgccgga cctcgacgtg cgcaagtgcc tcccctgcgg ccccgggggc 181 aaaggccgct gcttcgggcc caatatctgc tgcgcggaag agctgggctg cttcgtgggc 241 accgccgaag cgctgcgctg ccaggaggag aactacctgc cgtcgccctg ccagtccggc • 301 cagaaggcgt gcgggagcgg gggccgctgc gcggtcttgg gcctctgctg cagcccggac • 361 ggctgccacg ccgaccctgc ctgcgacgcg gaagccacct tctcccagcg ctgaaacttg • 421 atggctccga acaccctcga agcgcgccac tcgcttcccc catagccacc ccagaaatgg • 481 tgaaaataaa ataaagcagg tttttctcct ct

  4. SIGNAL SEQUENCE • 37-93 • Before signal sequence is the leader sequence • Mature Oxytocin 94-120 27 nucleotides = 9 amino acids

  5. Preproprotein 37- 411 • Signal seq, oxytocin + neurophysin I Proprotein 94-411 Oxytocin + neurophysin I • Mature Peptides modified from Proprotein • Trailer sequence responsible for PolyA-polymerase action

  6. 1 accagtcacg gaccctggac ccagcgcacccgcaccatgg ccggccccag cctcgcttgc 61 tgtctgctcg gcctcctggc gctgacctccgcctgctaca tccagaactg ccccctggga 121 ggcaagagggccgcgccgga cctcgacgtg cgcaagtgcc tcccctgcgg ccccgggggc 181 aaaggccgct gcttcgggcc caatatctgc tgcgcggaag agctgggctg cttcgtgggc 241 accgccgaag cgctgcgctg ccaggaggag aactacctgc cgtcgccctg ccagtccggc • 301 cagaaggcgt gcgggagcgg gggccgctgc gcggtcttgg gcctctgctg cagcccggac • 361 ggctgccacg ccgaccctgc ctgcgacgcg gaagccacct tctcccagcgctgaaacttg • 421 atggctccga acaccctcga agcgcgccac tcgcttcccc catagccacc ccagaaatgg • 481 tgaaaataaaataaagcagg tttttctcct ct

  7. Notice the 1st 3 nucleotides… • CODING STRAND ATG TEMPLATE STRAND TAC mRNA AUG…start codon Amino Acid Methionine (Met)

  8. tgc tac atc cag aac tgc ccc ctg gga acg atg tag gtc ttg acg ggg gac cct ugc uac auc cag aac ugc ccc cug gga Cys-tyr-ile-gln-asn-cys-pro-leu-gly

  9. WOBBLE EFFECT • 3rd base of tRNA may form H-bonds with more than 1 kind of nucleotide • Ie AAU and AAC  Asn

  10. TRANSCRIPTION FACTORS

  11. RECOGNIZE SEQUENCES • Transcription factors recognize DNA sequences inorder to target specific genes

  12. ROLE OF REGULATORY PROTEINS • Transcription factors are genetic switches • Master Genes ie HOX genes code for transcription factors • Related “Regulatory Proteins” in prokaryotes

  13. PROKARYOTIC REGULATION • No hormonal regulation • No introns  no splicing • No capping/tailing • Coupled transcription/translation

  14. Constitutive – always on; can be regulated (enzymes in glycolysis) • Inducible – off but can be switched on • Repressible – on but can be switched off

  15. OPERONS • Cluster of genes in which expression is regulated by operator-repressor protein interactions, operator region, and the promoter. • Promoter • Repressor • Operator (controlling site) • Coding sequences • Terminator

  16. Lac Operon • Lactose is an inducer • “Inducible” operon • Negative regulation

  17. -galactosidase (lacZ) • Breaks lactose into glucose + galactose. • Converts lactose to the allolactose, regulates lac operon. • Lactose permease (lacY) • Transports lactose across cytoplasmic membrane. • Transacetylase (lacA) • Function is not understood.

  18. Positive control when lactose is E. coli’s sole carbon source (but not if glucose also is present). • Catabolite activator protein (CAP) binds cAMP, activates, and binds to a CAP recognition site upstream of the promoter (cAMP is greatly reduced in presence of glucose).

  19. CAP changes the conformation of DNA and facilitates binding of RNA polymerase and transcription. • When glucose and lactose are present, E. coli preferentially uses glucose due to low levels of active CAP (low cAMP).

  20. Regulation of the trp operon: • “repressible” gene • 1. Repressor/operator interaction • When tryptophan is present, tryptophan binds to trpR gene product. • trpR protein binds to the trp operator and prevents transcription.

  21. Is TRP operon neg or pos regulation? • What type of regulation controls repressors/inducers?

  22. Jacob and Monod • What is true for E.coli is also true for the elephant!

  23. GENETIC SWITCHES • A switch includes.. • Binding protein • Binding protein recognizes a strecth of DNA

  24. Significance? • Mutate the gene encoding the transcription factor or the DNA sequence to which it binds and gene expression can be altered!

  25. GENE INACTIVATION • 1. CHROMATIN structure – Heterochromatin (tight– gene off) vs Euchromatin (loose – gene on) • 2. Methylation – adding methyl group to inactivate genes on DNA • 3. small RNA affects chromatin structure / interferes with transcription (RNAi system)

  26. Methylation • Reinforces inactivation • Involved in Barr-Body (inactive X chromosome)

  27. TRANSCRIPTIONAL CONTROL • Signals (hormones) in eukaryotes • Environmental- heat shock proteins • Regulator proteins (Transcription factors) – bind to TATA (like prokaryotes) • UPEs (Upstream Promoter Elements) – increase efficiency of RNA pol.

  28. Example… • Glucocorticoids released by stress bind to steroid receptor (in liver)  forms complex  binds to DNA  activates genes involved in gluconeogenesis

More Related