DNA and The Language of Life

1. DNA and The Language of Life

2. Objectives… • Chapter • Structure of DNA • How proteins are made • Mutations • Today: • Early experiments that led to discovery of DNA

3. Guided Question • What do the experiments of Mendel, Morgan, Griffith, Avery, Hershey & Chase show us about science?

4. Most Significant Biological Discovery of the 20th Century • DNA • “Life’s Blue Prints” • Mystery of what makes us humans Our “design” is 95-98% similar to chimpanzees 85% similar to mice

5. How did we Discover DNA Go to the DNA Discovery Center Of COURSE!

6. First Steps Towards DNA • Remember • Mendel – Inheritance (chromosomes) • Morgan – Sex Linked Genes • But what is the hereditary information? • Griffith • Avery • Hershey & Chase

7. 1920s, studying two strains of bacteria One fatal pneumonia, the other none fatal Rough: none (mice live) Smooth: capsule (mice die b/c immune system cant break it) Frederick Griffith & The “Transforming Factor”

8. What this showed… • Some “substance” in the deadly strain remained active despite the heat treatment • Caused the heritable change in the other strain • What we know today • bacteria can salvage genes from their environment from bacteria that have died. The DNA from the heated smooth “jumped” into the rough bacteria… Overwhelmed immune system and killed mice

9. But WHATIS the “transformed” substance? • Focused on either protein or DNA • (from other experiments like Mendel & Morgan) • Oswald Avery tested Griffith’s heat-treated deadly strain with… • Protein destroying enzymes • Bacteria killed • DNA destroying enzymes • Bacteria didn’t kill

10. So it’s settled then? • DNA too simple!!??? • Only 4 nucleotide bases?? • ….protein has 20 AA!?? • Hershey & Chase • Used Avery’s idea applied to viruses!! • Protein coat & DNA (not made of cells!) • Bacteriophage (bacteria-infecting virus)

11. Trial 1 Tested protein coat Radioactive isotope of sulfur on protein coat CONCLUSION No radioactivity Trial 2 Tested DNA Radioactive isotope of phosphorus in DNA CONCLUSION Radioactive! Hershey & Chase’s Bacteriophage

12. FINALLY • DNA is the “transforming factor” that carries hereditary information

13. Making Connections • Make a “web” connecting the experiments and conclusions of the following scientists • Mendel • Morgan • Griffith • Avery • Hershey & Chase How are they connected?

14. Example • Guided Question… • What does this show us about science? Surviving mice had resistance passed down Mendel Morgan Avery Hershey & Chase Patterns of Inheritance with Pea Plants

15. Pre-View Checklist etc Post-View Checklist DNA Check List

16. Building Blocks of DNA • Know DNA is the genetic material passed from parent to offspring • How is it arranged? • Does it matter? • How is it able to store genetic information, copy it and pass it to offspring? Structure & Function!!

17. Building Blocks of DNA • Genetic heredity stored in DNA • Deoxyribonucleic Acid (nucleic acid) • Molecule built from nucleotides (monomers) • 4 types of nucleotides made DNA • 4 types of nitrogen bases made nucleotides

18. Nitrogen Bases • 4 Nitrogen Bases • Thymine (T) • Cytosine (C) • Adenine (A) • Guanine (G) Pyrimidines (single rings) Purines (double rings)

19. DNA Structure • Nucleotides covalently bonded • Sugar of one – phosphate of next • Forms sugar-phosphate “backbone” • Nitrogen bases attach to backbone • Nucleotides can bond in any order • GACCTCATATACATGACTACAGAGG

20. DNA Structure • Rosalind Franklin & Maurice Wilkins • Photographed DNA (helix) • James Watson & Francis Crick • Double helical shape • Sugar phosphate backbone on outside • Nitrogen bases on the inside

21. Base Pairs • DNA sequence GATCATTACATTAAAAG • “other side of helix” is the complement • A-T • C-G “Down the Slide” = sequence (any order) “Across the Bridge”= complement

22. 11.3 DNA Replication What we are looking at today • How DNA replicates • Relationship between genes and proteins • How proteins are made

23. DNA Replication • How does a cell copy its genetic material? • Replication • Double helix separate • Copy instructions (DNA) with a DNA template that produces a new, complementary strand for each of the old template strands • (DNA copied before or after cell division?)

24. DNA Replication • DNA replication starts at “origins of replication” • Outwards in both direction (bubble) • Eukaryotic DNA = many origins (efficient) • Many enzymes catalyze replication • DNA polymerase • Covalent bonds b/w nucleotides of new DNA & old • Very few errors

25. Leading and Lagging Strands…what? When the two parent strands of DNA are separated to begin replication, one strand is oriented in the 5' to 3' direction while the other strand is oriented in the 3' to 5' direction. DNA replication is inflexible… DNA polymerase (enzyme), only functions in the 5' to 3' direction. This means that the daughter strands are synthesize through different methods, one adding nucleotides one by one in the direction of the replication fork the other able to add nucleotides only in chunks (backwards) The first strand, which replicates nucleotides one by one is called the leading strand; the other strand, which replicates in chunks, is called the lagging strand.

26. DNA Replication • Original parent strand of DNA 5’  3’ and 3’  5’ • DNA helicase (bonds?) • DNA polymerase Direction, Okazaki, Leading, Lagging.. • Replication Fork, origins of replication • Eukaryotic Vs Prokaryotic? Using the information above, draw me an illustrated picture of DNA replication

28. 2 1 2 3 5 1 3 4 5 4

30. 11.4 Making Proteins • Genotype & Phenotype • Sequence of nucleotide bases in DNA (genes) • Proteins and their functions (traits) • Relationship between genes and proteins? • Tatum & Beadle • Genes dictate production of polypeptide (effect larger molecules like enzymes of proteins

31. Pause!! • Ready 11.4 and complete 5 Post it responses!

32. DNARNAProtein • Language of genes are in sequence • Connection b/w gene and polypeptides? (enzymes /proteins?) • RNA (ribonucleic acid)= SINGLE ribose • Uracil, U-A … no THYMINE G-C still DNA is converted into RNA during transcription..

33. Transcription • DNA nucleotide sequence converted into single stranded mRNA (transcribed) • RNA leaves nucleus and directs protein synthesis in the cytoplasm • Transcribe a speech • Same language, but changes form (spoken to written) In translation, we convert nucleic acid language into AA language

34. Introns and Exons • During Transcription

35. Translation • Converting nucleic acid AA through use of codons • Three base “word” that codes for one AA • Several codons form a sentence that forms the polypeptide (protein)

36. The Triplet Code • Codons = protein forming codes • DNA sequence RNA sequence AUGUCUUAUAGUUGA START SER TYR SER STOP

38. A G U A C U U U A C G G U A A Start Methionine Threonine Leucine Arginine Stop The Genetic Code • Transcription • mRNA • Carries protein making instructions to site of translation • “message” is translated from language of RNA to language of amino acids by using “codons”

39. A U G A C U U U A C G G U A A Start Methionine Threonine Leucine Arginine Stop RNA sequence Codon-Amino Acid Table This is the process of translation!!

40. Serine (AA) A G U A C U U U A C G G U A A U U C G A G Topic 2: Translation • Second Step of Protein Synthesis (in cytoplasm) • (mRNA has left nucleus) • Another type of RNA (tRNA) carry complement bases & amino acids to mRNA • Anti-codon complement base “codon” that matches to mRNA strand Trp mRNA

41. Topic 3: Translation Steps • mRNA moves into cytoplasm as a ribosome attached onto mRNA at the “START” location (AUG) on the “P” site of the ribosome (has 1 amino acid) • Next tRNA comes in and attaches its complementary anticodon to the mRNA codon…also attaches its amino acid

42. Serine (AA) A U G A G U U U A C G G U A A U U A C A C Translation Animation! Methionine (AA) Start A Site P Site

43. Asparagine (AA) Serine (AA) Methionine (AA) Start A U G A G U U U A C G G U A A A U C A A U Translation Animation! A Site P Site

45. codon Anti-codon

46. Mutations • Mutagen- cause of mutation • Base substitution & base deletion/insertion • Substitution (not such a big problem) • GAA and GAG code for the same amino acid • Deletion/Insertion (PROBLEM) • Changes the following sequence

47. QUIZ FRIDAY!! • 11.3-11.6 • Tuesday- Review • Wednesday- TEST Complete 11.6 Concept Checks (by end of period!)