1 / 19

Tomato Genome Sequencing: Indian Contribution on Chromosome 5

Tomato Genome Sequencing: Indian Contribution on Chromosome 5. International Tomato Genome Sequencing Project. Country. USA. Korea. China. UK. India. NL. France. Japan. Spain. USA. China. Italy. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. Chromosome. Mb. 24. 26. 26. 19.

morgan
Download Presentation

Tomato Genome Sequencing: Indian Contribution on Chromosome 5

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Tomato Genome Sequencing: Indian Contribution on Chromosome 5

  2. International Tomato Genome Sequencing Project Country USA Korea China UK India NL France Japan Spain USA China Italy 1 2 3 4 5 6 7 8 9 10 11 12 Chromosome Mb 24 26 26 19 12 20 27 17 16 10 13 11 T=220 To sequence BACs 246 268 274 193 111 213 277 175 164 108 135 113 T=2276 0 µm 53.8 Mb 64.7 Mb 64.7 Mb 80.0 Mb 82.1 Mb 80.3 Mb 81.8 Mb 76.4 Mb 83.6 Mb 85.6 Mb 88.5 Mb Euchromatin 108.0 Mb Heterochromatin 70 µm

  3. Indian Initiative on Tomato Genome Sequencing Telomeric Region University of Delhi South Campus Euchromatic Region UDSC & NIPGR Akhilesh K. Tyagi Jitendra P. Khurana Paramjit Khurana Arun Sharma (0-60 cM) Heterochromatic Region National Research Centre on Plant Biotechnology Centromeric Region Nagendra K. Singh T. Mohapatra T. R. Sharma K. Gaikwad Heterochromatic Region NRCPB (69-119 cM) National Institute for Plant Genome Research Euchromatic Region Debasis Chattopadhyay Sabhyata Bhatia Telomeric Region

  4. Criteria for BAC selection and confirmation • Selection of two candidate seed BACs on chromosome 5 • specific marker • 100 kb or more in size • end sequence availability at SGN • 2. Purity check of bacterial stock • Hind III fingerprint of DNA isolated from six independent colonies • 3. PCR amplification of genetic markers/overlapping region • two marker/overlapping region-specific primer pairs • 4. BAC verification by direct sequencing • using two marker/overlapping region-specific primers • using vector-specific SP6 and T7 primers • 5. Size estimation/confirmation of BAC clone • by CHEF analysis of Not I digested BAC DNA • 6. Validation of BAC on chromosome 5 using Introgression Lines • polymorphism in PCR products • SNP detection of non-polymorphic bands

  5. Marker:CT101 Seed BAC:LE_HBa0191B01 Haplotype 1: -ACCCCTCAATATTTCGCTCCAA Haplotype 2:TGTATACTTGCGCCAGTTCAGGG Haplotype 1: M82, IL 5-2, IL 5-3, IL 5-4, IL 5-5, LE_HBa0191B01 Haplotype 2: L. pennellii, IL 5-1 L. esculentum (M82) L. pennellii IL 5-1 IL 5-2 IL 5-3 IL 5-4 IL 5-5 Confirmation of marker CT101 and its assigned seed BAC position on chromosome 5

  6. Confirmation of markers and their assigned seed BAC positions on chromosome 5

  7. Haplotype 1: -ACCCCTCAATATTTCGCTCCAA Haplotype 2:TGTATACTTGCGCCAGTTCAGGG Haplotype 1: M82, IL 5-2, IL 5-3, IL 5-4, IL 5-5 Haplotype 2: L. pennellii, IL 5-1 Fine mapping of IL5-1 boundaries IL5-1 Chr 5 M82 CT101 (0 cM) + M82 TG623 (8 cM) + IL5-2 L. pennellii CT53(13.5cM) L. pennellii TG432 (21 cM) + IL5-1 IL5-1 C2_At1g26810 (23 cM) + C2_At1g30110 (25 cM) - CT167 (30 cM) - IL5-2 IL5-2 C2_At1g26810 (23 cM) C2_At1g30110 (25 cM) Original Modified Haplotype 1: AGAGTAGGTTCCATT Haplotype 2:GAGTACG------CC Haplotype 1: M82, IL 5-1, IL 5-3, IL 5-4, IL 5-5 Haplotype 2: L. pennellii, IL 5-2 CT101 (0 cM) CT167 (30 cM)

  8. S. lycopersicum S. pennellii S. lycopersicum S. pennellii Loss of site S. lycopersicum S. pennellii Chromosome 6 Chromosome 7 Chromosome 8 Chromosome 9 Chromosome 10 Chromosome 11 Chromosome 12 1 kb ladder Chromosome 5 100 bp ladder S. pennellii Chromosome 1 Chromosome 2 Chromosome 3 Chromosome 4 S. pennellii S. lycopersicum 1 kb ladder IL 5-3 S. lycopesicum IL 5-1 IL 5-2 IL 5-4 IL 5-5 100 bp ladder Identification of new markers on tomato chromosomes using CAPS IL5-1 13 cM IL5-2 CAPS designing 43 cM IL5-3 IL5-4 IL5-5 Mapping marker in different DNA pools Fine mapping to an IL-bin Chr. 5

  9. New BACs mapped on tomato chromosomes using CAPS markers 7 3 5 4 9 6 3 1 3 6 7 4 IL-bin Mapping completed for 50 BACs

  10. BAC: LE_HBa0189E17 Marker: T0564 (11 cM) BAC: LE_HBa0309L13 Marker: C2_At2g01110 (37 cM) BAC: LE_HBa0298C03 Marker: TG69 (60 cM) BAC: LE_HBa0169M21 Marker: T1360 (73 cM) BAC: LE_HBa0138J03 Marker: T1746 (84 cM) BAC: LE_HBa0251J13 Marker: TG185 (119 cM) Mapping of BAC clones on chromosome 5 using FISH Chromosome 5 0 cM 11 cM UDSC + NIPGR 37 cM 43.7 cM 46 cM 60 cM ? cM 73 cM 84 cM NRCPB 119 cM

  11. The path for genomic sequencing Single streak of BAC clones from seed BAC library DNA extraction DNA fingerprinting (HindIII-digested) for BAC stock purity CHEF-analysis for size estimation PCR with genetic marker for re-confirmation IL-mapping for chromosome 5-specificity presence of SNP/indels Polymorphism in PCR (digested) products Haplotype 1 TACGTG...TTAT 2 CGAACAI/DGACA 1: M82, IL 5-2, IL 5-3, IL 5-4, IL 5-5, seed BAC 2: L. pennellii, IL 5-1 Shotgun cloning and sequencing Assembly of sequence BAC annotation Selection of extension BAC Searching for STCs (Sequence Tag Connector) SGN end-sequence database Overgo hybridization

  12. LE_HBa0191B01 LE_HBa0169M21 0 73 SL_MboI0050C14 LE_HBa0132D03 LE_HBa0201O22 SL_MboI0004P04 SL_EcoRI0101I15 SL_MboI0076A17 SL_MboI0005B15 76 7 SL_EcoRI0086I08 LE_HBa0135A02 E LE_HBa0261K11 LE_HBa0042B19 10 LE_HBa0050A12 SL_EcoRI0064A20 LE_HBa0224J02 LE_HBa0009H01 SL_EcoRI0077B22 LE_HBa0189E17 11 LE_HBa0138J03 SL_MboI0079D24 84 LE_HBa0115F01 SL_MboI0095J08 SL_MboI0093K24 SL_MboI0037H06 15.5 LE_HBa0179E24 LE_HBa0152J14 LE_HBa0058L13 H LE_HBa0060G21 LE_HBa0065K15 102.5 SL_EcoRI0066O01 LE_HBa0145P19 LE_HBa0011D08 LE_HBa0099K13 SL_MboI0084G04 LE_HBa0166A02 105 LE_HBa0003C20 C SL_EcoRI0057J03 107 LE_HBa0040C21 LE_HBa0168M18 UDSC & NIPGR NRCPB Sequencing status of BACs on chromosome 5 LE_HBa0207N23 LE_HBa0047J14 SL_MboI0118J08 SL_EcoRI0028N03 LE_HBa0210G09 SL_EcoRI0122H05 H LE_HBa0309L13 37 LE_HBa0025A19 SL_EcoRI0037P02 LE_HBa0161A14 LE_HBa0131D04 SL_EcoRI0082N07 44 108 LE_HBa0147F10 LE_HBa0023M16 LE_HBa0066P15 SL_Mbo0115G01 Phase III 51 SL_MboI0079C22 LE_HBa0142A20 57 LE_HBa0193P17 LE_HBa0057G22 LE_HBa0196G23 60 LE_HBa0298C03 Phase II SL_EcoRI0114E01 LE_HBa0141A12 E LE_HBa0190L02 LE_HBa0205O12 LE_HBa0239D11 Phase I SL_MboI0129F09 115 SL_EcoRI0087C17 SL_EcoRI0019P03 LE_HBa0013K15 61 LE_HBa0073P05 Library LE_HBa0251J13 SL_MboI0060C10 119 LE_HBa0031K11 LE_HBa0089M06 LE_HBa0042L17 SL_MboI0101E05 * Sequenced by China LE_HBa0076P16 LE_HBa0018K09 LE_HBa0107A04* LE_HBa0056N10 LE_HBa0059E05 SL_EcoRI0125O05

  13. Known genes Putative genes Expressed genes No evidence genes Gene prediction & annotation of some sequenced BAC clones 5% 16% 23% 56%

  14. Important genes present on some BAC clones

  15. Mining of important classes of genes using tomato ESTs No. of Unique assembled ESTs – ~48,000 Total no. of TF:1463 Mapped:237 (16%) Total no. of R-like genes:238 Mapped: 80 (33%) Total no. of lectins:71 Mapped:27 (38%)

  16. 100 90 80 Known (identical) 65.7% Putative (<e-100) 70 No evidence 56.9% 0.2% 54.4% 54.2% 60 19.9% 20.0% 50 37.3% Percentage 40 33.1% Expressed (<e-5) 30 13.1% 20 5411 6562 3299 5428 3722 9977 5680 10 Similar to (between e-100 and e-5) Eugene TAIR RAP Swiss-Prot TrEMBL RefSeq No hit 46.8% Proteins Functional annotation of predicted proteins by BLASTP (ITAG)

  17. Functional annotation of predicted proteins Predictions Eugene TAIR RAP BLASTP hits Swiss-Prot Ref-Seq TrEMBL Number of genes per 10 kb sequence

  18. Highlights 1. All BAC clones are being mapped on chromosome 5 by using chromosome 5-specific introgression lines 2. Ten BAC clones have been mapped on chromosome 5 by FISH 3. Eighty three BAC clones covering approximately ~8.0 Mb region on chromosome 5, have been mapped 4. Current status of BAC clones from chromosome 5, selected for sequencing * Thirty one BACs are completed (all submitted to NCBI and SGN) * Thirty one BAC clones are in phase II * Thirteen BAC clones are in phase I * Eight BAC clones are at various stages of library preparation and sequencing 5. Twelve clones, previously mapped to chromosome 5 have now been confirmed on other chromosomes. 6. Designing of CAPS markers using BAC ends in process. 7. BLASTP analysis as part of functional annotation of tomato genome as part of ITAG.

  19. Contributors IITGS UDSC NRCPB NIPGR Prof. Akhilesh K. Tyagi Prof. J. P. Khurana Prof. P. Khurana Dr. A. K. Sharma Dr. Saloni Mathur Dr. Shailendra Vyas Mr. Amol Solanke Mr. Rahul Kumar Dr. Vikrant Gupta Ms. Rashmi Jain Mr. Rupesh K Jain Mr. Shaji Joseph V Dr. Nagendra K. Singh Dr. T. Mohapatra Dr. T. R. Sharma Dr. K. Gaikwad Mr. Awadhesh Pandit Dr. Pradeep K. Singh Mr. A. Kumar Dr. Rekha Dixit Dr. Archana Singh Mr. Vivek Dalal Dr. Manju Singh Dr. I. A. Ghazi Dr. Debasis Chattopadhyay Dr. Sabhyata Bhatia Dr. S. Dewan Ms. P. Chowdhury Ms. S. Shridhar

More Related