From Bugs to Barcodes: Using Molecular Tools to Study Biodiversity

1. From Bugs to Barcodes: Using Molecular Tools to Study Biodiversity Mandy Butler, Heather Henter, Stephanie Mel University of California, San Diego

2. Biodiversity

3. Biodiversity knowledge gap

4. How can we conserve what we don’t know we have?

5. How can we address the biodiversity knowledge gap?

6. BARCODING DNA BARCODE specific region in an organism's DNA as a genetic marker to identify species How? compare DNA sequence with sequences in a public reference library (GenBank or BOLD)

7. HOW?

8. Why is barcoding useful? Anyone that can do PCR and pay for sequencing can generate barcode data Morphological identification difficult for non-specialist

9. HOW? 1. Keep a record of class activity 2. Compare your sequence data to published sequences 3. ID specimen 4. Analyze data

10. HOW? !! !! Publish

11. Student collaboration ecology courses molecular biology courses Also, independent study students

12. Invertebrate Animals Scale=5 mm

13. Scripps Coastal Reserve

14. Hypothesis testing vs. Discovery science Do flower-inhabiting thrips (Thysanoptera) specialize on different species of plant host? vs. What thrips species are at our reserve?

15. DNA Preservation Best: 95% ethanol & -20 C freezer, change ethanol once OK: dry Worst: 70% ethanol Be sure to label each specimen with date, locality, collector

16. Collaborations

17. San Diego – Biodiversity hotspot San Diego – BOL?

18. Education –BOL?

19. Today’s insect collecting Each group: insect net aspirator & aspirator vials 2 mL vials with 70% ethanol blank labels white paper plate fine paint brush sharp pencil kill jar

20. History of Barcoding http://www.dnabarcoding101.org/

21. Barcoding protocol Insect collection DNA extraction Amplification of COI gene by PCR Direct sequencing of cleaned up PCR product Analysis of sequence

22. DNA EXTRACTION • Remove leg if large insect • Grind up entire insect if very small • Follow extraction protocol

23. Small ribosomal RNA The Mitochondrial Genome D-Loop mtDNA DNA Cytochrome b ND1 ND6 ND5 COI ND2 COI L-strand H-strand Typical Animal Cell ND4 ND4L COII ND3 COIII ATPase subunit 8 ATPase subunit 6 Mitochondrion An Internal ID System for All Animals Slide from David E. Schindel

24. PCR - Polymerase Chain Reaction 5’ 3’ CO1 DNA 3’ 5’ 30+ cycles of amplification PCR product: Billions of copies of CO1 DNA sequence from your organism of interest

25. Run PCR product on a gel

26. Check to see if correct size PCR product Follow clean-up protocol

27. Send samples out for sequencing…

28. Compare CO1 sequences from different organisms Org 1 - CTGCTGACATCGATGCTGATCGGAGTATCATAA Org 2 - CTGCTGACATCGATGCTGATCGGACTATCATAA Org 3 - CTGCTGACATTGATGCTGATCGGACTATCATAA Org 4 - CTGCTGACATTGATGCTGATCGGACTATCATAA Org 5 - CTGCTGACATCGATGCTGATCGGACTATCATAA

29. Discover a new species! Ask exciting scientific questions! Brooklyn vs. Bronx Bedbugs What lives in the subway? Expose a local restaurant! Publish!

30. Why is a mitochondrial gene used for barcoding? Review of Mitochondrial DNA • Circular DNA, 17000 bp • Hundreds of copies per cell • Inherited from mother only – so haploid • No recombination • Contains 37 genes – no introns http://www.geneticorigins.org/mito/intro.html

31. The CO1 gene is the standard gene for barcoding in animals • CO1 is a protein coding gene of about 1500 bp • The COI region that is used for barcoding includes the first half of the gene and is approximately 650 basepairs long • PCR is used to amplify this region; the PCR product is then sent for sequencing

32. 1. Mitochondrial genes are haploid • In doing barcoding, we want to make the sequencing part as easy as possible • We want to be able to isolate DNA, amplify it and sequence it without having to clone the DNA • Thus it is important to use a haploid gene as our identifying gene. • If you used a diploid gene, you would get product with possible 2 different sequences.

33. 2. Mitochondrial genes are present in high copy numbers in cells

34. 3. Mitochondrial genes exhibit more differences in sequence among species than nuclear genes, and less difference within species • Sequence differences among closely related animal species average 5- to 10-fold higher in mitochondrial than nuclear genes. • Intraspecific variation in mitochondrial DNA is low in most animal species. • Thus small intraspecific and large interspecific differences make distinguishing genetic boundaries between species easier, enabling more precise identification.

35. Universal primers • “Universal primers” are primers that are designed to areas in genes that are highly conserved among different species. • Thus universal primers are not species specific • This means that the primers are not totally complementary to the sequence in your insect sample but they are similar enough to hybridize at a low annealing temperature sample • The sequence in the CO1 gene in between where the primers hybridize is less well conserved and thus can be used to differentiate members of different species.

36. PCR conditions • Since we do the annealing step at 42oC, it is possible that non-specific PCR products are made • We run a gel to see if the PCR worked, and if there is a single PCR product of the expected size, we clean up the PCR product and send for sequencing. • Sequencing is done using the forward and reverse primes in separate runs • We will then analyze the sequences and use Blast to try determine the genus and species of your samples

37. Bioinformatics • First we determine if the sequence for the insect is in Genbank by doing a Blast • We will consider any hit with an identity of 97% or better the same species. • If the match is less than 97%, it means the barcode sequence for theinsect is not in Genbank

38. Intraspecies genetic diversity • Once we have a set of sequences from the same organisms (i.e., same genus and species) we will also look at genetic diversity within that organism (SNPs)