slide1
Download
Skip this Video
Download Presentation
A.f. insert

Loading in 2 Seconds...

play fullscreen
1 / 28

A.f. insert - PowerPoint PPT Presentation


  • 107 Views
  • Uploaded on

Is there an insert?. A.f. insert. Each organism has a specific set of restriction enzymes. Eco RI from E scherichia co li Bam HI from B acillus am yloliqueraciens Pvu I and Pvu II are different enzymes from same strain. Originally purified by individual labs, Nathans, Smith

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' A.f. insert' - miriam


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
each organism has a specific set of restriction enzymes
Each organism has a specific set of restriction enzymes
  • EcoRI from Escherichia coli
  • BamHI from Bacillus amyloliqueraciens
  • PvuI and PvuII are different enzymes from same strain.
  • Originally purified by individual labs, Nathans, Smith
  • Now supplied by companies - GE, NEB, Promega, BRL

Ch. 3-1

slide4

Restriction enzymes - endonucleases,

Cleave a specific DNA sequence

Protect bacteria from phage infection,

digest phage DNA after infection

Cellular DNA protected by methylases -

block restriction enzyme activity

Ch. 3-1

slide6

Sequence Recognition and cleavage:

a) 5\' overhang EcoRI GAATTC G pAATTC

CTTAAG CTTAAp G

b) 3\' overhang KpnI GGTACC GGTAC pC

CCATGG Cp CATGG

c) Blunt end SmaI CCCGGG CCC pGGG

GGGCCC GGGp CCC

Ch. 3-2

slide7

Sequence Recognition and cleavage:

d) Degenerate:

AvaII GGWCC: GGTCC, GGACC

AvaI CPyCGPuG CTCGAG

Py stands for pyrimidine- T or CCTCGGG

Pu stands for purine - A or GCCCGAG

CCCGGG

C TCGAG C CCGGG CCCGAG

GAGCT C GGGCC C GAGCCC

DdeI CTNAG: CTAAG, CTGAG, CTCAG, CTTAG

BbsI cleaves GAAGACNN

CTTCTGNNNNNN

Ch. 3-2

slide9

Sequence Recognition and cleavage:

e) Isoschizomers:Different enzymes cut the same seq.

MboI, Sau3A, DpnII GATC N pGATCN

CTAG NCTAGp N

f) Overlaps: Two enzymes that give the same overhang

BamHI GGATCC G pGATCC

CCTAGG CCTAGp G

Sau3ANGATCN N pGATCN

NCTAGN NCTAGp N

Ch. 3-2

slide11

Activity: in units which corresponds to a specified level of enzyme activity.

NEB defines a unit as:

“One unit of restriction endonuclease activity is defined as the amount of enzyme required to completely digest 1 g of substrate DNA in a total reaction volume of 0.05 ml in one hour using the NEB buffer provided.”

Ch. 3-3

slide12

Restriction enzymes are proteins with optimal conditions

Activity of an enzyme can change under different conditions:

pH- 7.5, 8.0, 8.5

salt concentration- 20 mM, -150 mM

divalent cations- Mg++

reducing reagent- DTT

carrier protein-BSA

temperature- 37C, RT, 60C

  • Before setting up a restriction digest check to make sure that you are using the proper conditions!

Ch. 3-4

slide14

| A | B | C | D | E | F | H | K | M | N | P | R | S | T | X |Z |

Enzyme Supplied

NEBuffer % Activity in NEBuffers

1 2 3 4

Aat II 4 0 50 50 100

Acc I 4 50 50 10 100

Acc65 I 3 + BSA 10 75 100 25

Aci I 3 25 50 100 50

Acl I 4 + BSA 10 10 0 100

Acu I 2 + SAM 50 100 50 100

Afe I * SE-Y 25 50 25 100

Afl II 2 + BSA 50 100 25 100

Afl III 3 + BSA 25 75 100 50

Age I 1 100 50 10 75

Ahd I 4 + BSA 25 75 0 100

Ale I 4 10 20 10 100

Alu I 2 100 100 75 100

Alw I 4 50 100 10 100

AlwN I 4 50 100 50 100

Apa I @25°C 4 + BSA 25 50 0 100

ApaL I 4 + BSA 100 100 10 100

ApeK I @75°C 3 25 75 100 50

Apo I @50°C 3 + BSA 10 75 100 75

Asc I 4 0 10 10 100

Ase I 3 NR 75 dd100 NR

AsiS I 3 + BSA 50 100 100 50

Ava I 4 10 75 10 100

Ava II 4 50 75 10 100

Avr II 2 100 100 50 100

Bae I @25°C 2 + BSA + SAM 50 100 50 75

BamH I Udd + BSA 75 100 50 75

Ban I 4 50 100 50 100

1

2

3

4

NEB Buffer Compatibility Chart

NEBuffer 1 (yellow): 10mM Tris

Propane (pH 7.0), 10 mM MgCl2, 1mM DTT

NEBuffer 2 (blue): 10mM Tris (pH 7.9), 10 mM MgCl2, 50 mM NaCl, 1mM DTT

NEBuffer 3 (red): 50mM Tris (pH 7.9), 10 mM MgCl2, 100 mM NaCl, 1mM DTT

NEBuffer 4 (blue): 20mM Tris-acetate (pH 7.9), 10 mM Mg acetate, 50 mM K acetate, 1mM DTT

slide15

Setting up a restriction digest

1. Think about the experiment:

Mapping or cloning?

Determine which enzymes to use

Are they in the freezer??

Determine buffer and reaction conditions

Are the enzymes compatible?

Ch. 3-4

slide16

Determine controls:

uncut DNA

parent vectors,

size standards

3. Calculate how much DNA to add.

Analytical or preparative?

Ch. 3-5

slide17

Set up the Reaction:

  • Add in the following order:
  • Single Multiple
  • Sterile ddH2O 7.0 l 35.0 l
  • 10 X restriction buffer 2.0 l 10.0 l
  • Miniprep DNA (0.5 g) 10.0 l **none**
  • Enzyme (20 U/l) 1.0 l 4.0 l
  • Total volume 20.0 l 10.0 l Mix aliquot
  • 10.0 l DNA
  • The two most important rules in enzymes
  • Always keep enzymes on ice or in a cooler.
  • Always use a fresh tip when pipeting from the enzyme stocks.

Ch. 3-6

slide18

5. Incubate reactions at the appropriate temperature for the appropriate time.

Usually 37˚C and incubate 1 hr or more.

6. If running on a gel: Add gel loading dye

EDTA - Stops reaction.

Dyes (BPB and XC) - to help see sample while

loading and monitor electrophoresis

Glycerol - so sample sits at bottom of the well

Ch. 3-6

slide21

SP CTCCGAGATCTGGACGAGC>

CTCCGAGATCTGGACGAGCTTTTTTTTTTTTTCTCGGGAAGCGCGCCATT

1 ---------+---------+---------+---------+---------+ 50

GAGGCTCTAGACCTGCTCGAAAAAAAAAAAAAGAGCCCTTCGCGCGGTAA

INSERT

|

KpnI SmaI EcoRI PstI BamHI

| | | | |

GTGTTGGTACCCGGGAATTCGGCCATTATGGCCTGCAGGATCCGGCCGCC

61 ---------+---------+---------+---------+---------+ 100

CACAACCATGGGCCCTTAAGCCGGTAATACCGGACGTCCTAGGCCGGCGG

XbaI XhoI HindIII

| | |

TCGGCCCAGTCGACTCTAGACTCGAGCAAGCTTATGCATGCGGCCGCAAT

121 ---------+---------+---------+---------+---------+ 180

AGCCGGGTCAGCTGAGATCTGAGCTCGTTCGAATACGTACGCCGGCGTTA

TCGAGCTCACTTGGCCAATTCGCCCTATAGTGAGTCGTATTACAAT

181 ---------+---------+---------+---------+------ 196

AGCTCGAGTGAACCGGTTAAGCGGGATATCACTCAGCATAATGTTA

<GCGGGATATCACTCAGCATAATGTTA- BP

Ch. 3-5

slide23

1. Dilute aliquots of your miniprep plasmid DNA samples 50-fold. Label four fresh microfuge tubes and combine 98 l of H2O with 2 l of plasmid DNA. Mix each sample tube by vortexing.

Lab 6-4

slide24

Prepare the following 5 Rxns. PCR Mix:

  • 1 Rxn.5 Rxns. PCR Mix
  • Sterile ddH2O 18.0 l 90 l
  • SP Primer (10 pmole/l) 2.5 l 12.5 l
  • BP Primer (10 pmole/l) 2.5 l 12.5 l
  • Diluted Vector (~2 ng) 2.0 l** (DO NOT ADD DNA!)
  • =25.0 l

Lab 6-4

slide25

3. Obtain a strip of 4 Tubes of “PCR Beads.”

  • Label tubes
  • To each tube add:
  • one bead
  • 23 l of the “5 Rxn. PCR Mix.
  • 2 l of the appropriate diluted DNA
  • Mix each by gently tapping the tube.

Lab 6-4

slide26

I Initial Denaturation

94oC for 5 minutes (Complete denaturation)

II Amplification (Repeats steps 30X)

94oC for 1 minute (Denaturation of target DNA)

50oC for 1 minute (Annealing of primer to template DNA)

72oC for 1 minute (Elongation to produce new DNA strand)

III Additional Elongation

72oC for 5 minutes (Insures all DNA strands are full length)

IV Soak

4oC for ON. (Helps samples be stable)

slide28

Agarose Gel Electrophoresis:

DNA is negatively charged

Electric field causes the DNA fragments migrate through the gel to the positive electrode

Smaller fragments migrate through the gel faster

Separates DNA fragments on the basis of size

Ch. 3-12

ad