A f insert
This presentation is the property of its rightful owner.
Sponsored Links
1 / 28

A.f. insert PowerPoint PPT Presentation


  • 65 Views
  • Uploaded on
  • Presentation posted in: General

Is there an insert?. A.f. insert. Each organism has a specific set of restriction enzymes. Eco RI from E scherichia co li Bam HI from B acillus am yloliqueraciens Pvu I and Pvu II are different enzymes from same strain. Originally purified by individual labs, Nathans, Smith

Download Presentation

A.f. insert

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


A f insert

Is there an insert?

A.f. insert


Each organism has a specific set of restriction enzymes

Each organism has a specific set of restriction enzymes

  • EcoRI from Escherichia coli

  • BamHI from Bacillus amyloliqueraciens

  • PvuI and PvuII are different enzymes from same strain.

  • Originally purified by individual labs, Nathans, Smith

  • Now supplied by companies - GE, NEB, Promega, BRL

Ch. 3-1


A f insert

Restriction enzymes - endonucleases,

Cleave a specific DNA sequence

Protect bacteria from phage infection,

digest phage DNA after infection

Cellular DNA protected by methylases -

block restriction enzyme activity

Ch. 3-1


Restriction enzymes are used for cloning and analyzing dna fragments

Restriction enzymes are used for cloning and analyzing DNA fragments


A f insert

Sequence Recognition and cleavage:

a) 5' overhangEcoRIGAATTCG pAATTC

CTTAAGCTTAAp G

b) 3' overhang KpnIGGTACCGGTACpC

CCATGGCpCATGG

c) Blunt endSmaICCCGGGCCCpGGG

GGGCCCGGGpCCC

Ch. 3-2


A f insert

Sequence Recognition and cleavage:

d) Degenerate:

AvaII GGWCC:GGTCC, GGACC

AvaI CPyCGPuG CTCGAG

Py stands for pyrimidine- T or CCTCGGG

Pu stands for purine - A or GCCCGAG

CCCGGG

CTCGAGCCCGGGCCCGAG

GAGCTCGGGCCCGAGCCC

DdeI CTNAG: CTAAG, CTGAG, CTCAG, CTTAG

BbsI cleaves GAAGACNN

CTTCTGNNNNNN

Ch. 3-2


A f insert

Recognition sites for the SfiI restriction enzyme

Ch. 3-2


A f insert

Sequence Recognition and cleavage:

e) Isoschizomers:Different enzymes cut the same seq.

MboI, Sau3A, DpnIIGATCNpGATCN

CTAGNCTAGpN

f) Overlaps: Two enzymes that give the same overhang

BamHIGGATCCGpGATCC

CCTAGGCCTAGpG

Sau3ANGATCNNpGATCN

NCTAGNNCTAGpN

Ch. 3-2


A f insert

Ch. 3-3


A f insert

Activity: in units which corresponds to a specified level of enzyme activity.

NEB defines a unit as:

“One unit of restriction endonuclease activity is defined as the amount of enzyme required to completely digest 1 g of substrate DNA in a total reaction volume of 0.05 ml in one hour using the NEB buffer provided.”

Ch. 3-3


A f insert

Restriction enzymes are proteins with optimal conditions

Activity of an enzyme can change under different conditions:

pH- 7.5, 8.0, 8.5

salt concentration- 20 mM, -150 mM

divalent cations- Mg++

reducing reagent- DTT

carrier protein-BSA

temperature- 37C, RT, 60C

  • Before setting up a restriction digest check to make sure that you are using the proper conditions!

Ch. 3-4


A f insert

Ch. 3-4


A f insert

| A | B | C | D | E | F | H | K | M | N | P | R | S | T | X |Z |

EnzymeSupplied

NEBuffer% Activity in NEBuffers

1234

Aat II405050100

Acc I4505010100

Acc65 I3 + BSA107510025

Aci I3255010050

Acl I4 + BSA10100100

Acu I2 + SAM5010050100

Afe I *SE-Y255025100

Afl II2 + BSA5010025100

Afl III3 + BSA257510050

Age I1100501075

Ahd I4 + BSA25750100

Ale I4102010100

Alu I210010075100

Alw I45010010100

AlwN I45010050100

Apa I @25°C4 + BSA25500100

ApaL I4 + BSA10010010100

ApeK I @75°C3257510050

Apo I @50°C3 + BSA107510075

Asc I401010100

Ase I3NR75dd100NR

AsiS I3 + BSA5010010050

Ava I4107510100

Ava II4507510100

Avr II210010050100

Bae I @25°C2 + BSA + SAM501005075

BamH IUdd + BSA751005075

Ban I45010050100

1

2

3

4

NEB Buffer Compatibility Chart

NEBuffer 1 (yellow): 10mM Tris

Propane (pH 7.0), 10 mM MgCl2, 1mM DTT

NEBuffer 2 (blue): 10mM Tris (pH 7.9), 10 mM MgCl2, 50 mM NaCl, 1mM DTT

NEBuffer 3 (red): 50mM Tris (pH 7.9), 10 mM MgCl2, 100 mM NaCl, 1mM DTT

NEBuffer 4 (blue): 20mM Tris-acetate (pH 7.9), 10 mM Mg acetate, 50 mM K acetate, 1mM DTT


A f insert

Setting up a restriction digest

1. Think about the experiment:

Mapping or cloning?

Determine which enzymes to use

Are they in the freezer??

Determine buffer and reaction conditions

Are the enzymes compatible?

Ch. 3-4


A f insert

Determine controls:

uncut DNA

parent vectors,

size standards

3.Calculate how much DNA to add.

Analytical or preparative?

Ch. 3-5


A f insert

  • Set up the Reaction:

  • Add in the following order:

  • SingleMultiple

  • Sterile ddH2O7.0l35.0 l

  • 10 X restriction buffer 2.0l10.0 l

  • Miniprep DNA (0.5 g) 10.0l**none**

  • Enzyme (20 U/l)1.0l4.0 l

  • Total volume20.0l 10.0 l Mix aliquot

  • 10.0 l DNA

  • The two most important rules in enzymes

  • Always keep enzymes on ice or in a cooler.

  • Always use a fresh tip when pipeting from the enzyme stocks.

Ch. 3-6


A f insert

5. Incubate reactions at the appropriate temperature for the appropriate time.

Usually 37˚C and incubate 1 hr or more.

6. If running on a gel: Add gel loading dye

EDTA - Stops reaction.

Dyes (BPB and XC) - to help see sample while

loading and monitor electrophoresis

Glycerol - so sample sits at bottom of the well

Ch. 3-6


A f insert

Steps in the Polymerase Chain Reaction - PCR

Ch. 3-8


A f insert

DNA Amplification by PCR

Ch. 3-5

Ch. 3-9


A f insert

SP CTCCGAGATCTGGACGAGC>

CTCCGAGATCTGGACGAGCTTTTTTTTTTTTTCTCGGGAAGCGCGCCATT

1 ---------+---------+---------+---------+---------+ 50

GAGGCTCTAGACCTGCTCGAAAAAAAAAAAAAGAGCCCTTCGCGCGGTAA

INSERT

|

KpnI SmaI EcoRI PstI BamHI

| | | | |

GTGTTGGTACCCGGGAATTCGGCCATTATGGCCTGCAGGATCCGGCCGCC

61 ---------+---------+---------+---------+---------+ 100

CACAACCATGGGCCCTTAAGCCGGTAATACCGGACGTCCTAGGCCGGCGG

XbaI XhoI HindIII

| | |

TCGGCCCAGTCGACTCTAGACTCGAGCAAGCTTATGCATGCGGCCGCAAT

121 ---------+---------+---------+---------+---------+ 180

AGCCGGGTCAGCTGAGATCTGAGCTCGTTCGAATACGTACGCCGGCGTTA

TCGAGCTCACTTGGCCAATTCGCCCTATAGTGAGTCGTATTACAAT

181 ---------+---------+---------+---------+------ 196

AGCTCGAGTGAACCGGTTAAGCGGGATATCACTCAGCATAATGTTA

<GCGGGATATCACTCAGCATAATGTTA- BP

Ch. 3-5


A f insert

Ch. 3-10


A f insert

  • 1. Dilute aliquots of your miniprep plasmid DNA samples 50-fold. Label four fresh microfuge tubes and combine 98 l of H2O with 2 l of plasmid DNA. Mix each sample tube by vortexing.

Lab 6-4


A f insert

  • Prepare the following 5 Rxns. PCR Mix:

  • 1 Rxn.5 Rxns. PCR Mix

  • Sterile ddH2O 18.0 l90 l

  • SP Primer (10 pmole/l)2.5 l 12.5 l

  • BP Primer (10 pmole/l)2.5 l12.5 l

  • Diluted Vector (~2 ng)2.0 l** (DO NOT ADD DNA!)

  • =25.0 l

  • Lab 6-4


    A f insert

    • 3. Obtain a strip of 4 Tubes of “PCR Beads.”

    • Label tubes

    • To each tube add:

    • one bead

    • 23 l of the “5 Rxn. PCR Mix.

    • 2 l of the appropriate diluted DNA

    • Mix each by gently tapping the tube.

    Lab 6-4


    A f insert

    I Initial Denaturation

    94oC for 5 minutes (Complete denaturation)

    II Amplification (Repeats steps 30X)

    94oC for 1 minute (Denaturation of target DNA)

    50oC for 1 minute (Annealing of primer to template DNA)

    72oC for 1 minute (Elongation to produce new DNA strand)

    III Additional Elongation

    72oC for 5 minutes (Insures all DNA strands are full length)

    IV Soak

    4oC for ON. (Helps samples be stable)


    A f insert

    Ch. 3-12


    A f insert

    Agarose Gel Electrophoresis:

    DNA is negatively charged

    Electric field causes the DNA fragments migrate through the gel to the positive electrode

    Smaller fragments migrate through the gel faster

    Separates DNA fragments on the basis of size

    Ch. 3-12


  • Login