Genome 351,
Download
1 / 40

Today… - PowerPoint PPT Presentation


  • 127 Views
  • Uploaded on

Genome 351, 12 April 2013, Lecture 4. Today…. mRNA splicing Promoter recognition Transcriptional regulation Mitosis: how the genetic material is partitioned during cell division. In bacteria (most) mRNAs are co-linear with their corresponding genes. Promoter. terminator. gene.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Today…' - miller


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

Genome 351, 12 April 2013, Lecture 4

Today…

  • mRNA splicing

  • Promoter recognition

  • Transcriptional regulation

  • Mitosis: how the genetic material is partitioned during cell division


In bacteria (most) mRNAs are co-linear with their corresponding genes

Promoter

terminator

gene

AACTGACGA

+1

AACUGACGA

bacteria:

mRNA

AACGA


Events involved in rna processing

Noncoding corresponding genes

Coding sequence

Coding sequence

Non-coding

Non-coding

Non-coding

Non-coding

Non-coding

Non-coding

Continuous stretch of coding sequence

Continuous stretch of coding sequence

AAAAA

Transport to the cytoplasm

Events involved in RNA processing

Pre-mRNA

Intron

Exon1

Exon2


Why does transcript splicing occur? corresponding genes

Proteins can be modular

-Different regions can have distinct functions

and the modules can correspond to exons


Interrupted structure allows genes to be modular
Interrupted structure allows corresponding genesgenes to be modular

secretion

enzyme

binding module

cell anchor


Interrupted structure allows genes to be modular1
Interrupted structure allows corresponding genesgenes to be modular

Pre-mRNA:

secretion

enzyme

binding module

cell anchor

AAAA

secretion

secretion

enzyme

enzyme

binding module

binding module

cell anchor

cell anchor

Processed-mRNA


Alternative splicing or one mrnas exon is another one s intron
Alternative splicing or: corresponding genesOne mRNAs exon is another one’s intron!

Pre-mRNA:

secretion

secretion

enzyme

enzyme

binding module

binding module

secretion

enzyme

binding module

cell anchor

one alternative form

AAAA

Processed-mRNA


Alternative splicing or one mrnas exon is another one s intron1
Alternative splicing or: corresponding genesOne mRNAs exon is another one’s intron!

Pre-mRNA:

enzyme

binding module

secretion

enzyme

binding module

cell anchor

another alternative form

AAAA

enzyme

binding module

Processed-mRNA


mRNA corresponding genes

promoter

promoter

How do RNA polymerases know where to begin transcription and which way to go?

promoter

mRNA

gene

gene

gene

mRNA

First worked out in bacteria by:

-comparing sequences near the start sites of transcription of many genes

-by studying where RNA polymerase likes to bind to DNA


How do RNA polymerases know where to begin transcription and which way to go?

Comparing sequences at the promoter region of many bacterial genes provides clues:

direction of transcription

transcription start site

only coding (sense) strand is shown; all sequences 5’-3’

-35 region

-10 region

+1

consensus

sequence: TTGACAT…15-17bp…TATAAT


RNA polymerase binds to the consensus sequences in bacterial promoters

RNA polymerase binds to the -35 and -10 regions:

RNA polymerase

direction of transcription

TTGACAT

TATAAT

-35 region

-10 region

+1

Would you expect RNA polymerase to bind the other way around and transcribe in the reverse direction?


RNA polymerase binds to the consensus sequences in bacterial promoters

RNA polymerase binds to the -35 and -10 regions:

RNA polymerase

direction of transcription

TTGACAT

TATAAT

-35 region

-10 region

+1

Would you expect RNA polymerase to bind the other way around and transcribe in the reverse direction?


RNA polymerase binds to the consensus sequences in bacterial promoters

direction of transcription

RNA polymerase

RNA polymerase

TTGACAT

TATAAT

-35 region

-10 region

+1

Would you expect RNA polymerase to bind this sequence and initiate transcription?

TACAGTT

TAATAT

direction of transcription


mRNA promoters

How do RNA polymerases know where to begin transcription and which way to go?

In bacteria RNA polymerase binds specific sequences near the start site of transcription that orient the polymerase:

mRNA

gene

gene

gene

mRNA

TTGACAT

TATAAT

-10 region

-35 region

-10 region

-35 region

TAATAT

TACAGTT


In eukaryotes, RNA polymerase is regulated by DNA-binding proteins

transcription factors (TF’s):

RNA polymerase:

+1

But TF’s that bind to specific DNA sequences & to RNA polymerase can recruit RNA polymerase & activate transcription

RNA polymerase does not efficiently bind to DNA and activate transcription on its own

+1


In eukaryotes, RNA polymerase is regulated by DNA-binding proteins

transcription factors (TF’s):

RNA polymerase:

+1

But TF’s that bind to specific DNA sequences & to RNA polymerase can recruit RNA polymerase & activate transcription

Some TF’s can also inhibit transcription

+1


Switches and regulators a metaphor
Switches and Regulators - proteins A Metaphor

  • Switches control transcription (which take the form of DNA sequence)

    - Called regulatory elements (RE’s) or enhancers

    - Adjoin the promoter region, but can be quite distant

  • Regulators, which take the form of proteins that bind the DNA, operate the switches

    - Called transcription factors (TF’s)

  • When and how much RNA is made often is the product of multiple elements and regulators


Control of gene expression
Control of gene expression proteins

  • Each cell contains the same genetic blueprint

  • Cell types differ in their protein content

  • Some genes are used in almost all cells (housekeeping genes)

  • Other genes are used selectively in different cell types or in response to different conditions.


An imaginary regulatory region
An imaginary regulatory region proteins

RE6

RE5

RE1

RE4

RE2

RE3

Promoter


Expressing a regulatory gene in the wrong place can have disastrous consequences!!!

Example: Antennapedia gene in fruit flies

Antennapediagene is normally only transcribed in the thorax; legs are made.

A mutant promoter causes the Antennapedia gene to be expressed in the thorax and also in the head, where legs result instead of antennae!



Lactase levels in humans
Lactase levels in humans disastrous consequences!!!

Lactase levels

2

10

Age in years



The cellular life disastrous consequences!!!cycle

Mitosis: dividing the content of a cell

fertilized egg; a single cell!


Photo: David McDonald, Laboratory of Pathology of Seattle disastrous consequences!!!

Chromosomes - a reminder

How many do humans have?

  • 22 pairs of autosomes

  • 2 sex chromosomes

  • Each parent contributes one chromosome to each pair

  • Chromosomes of the same pair are called homologs

  • Others are called non-homologous


Homologous and non-homologous chromosomes disastrous consequences!!!

The zygote receives one paternal (p) and one maternal (m) copy of each homologous chromosome

1p

1m

2p

2m

3p

3m

21m

21p

22p

22m

Xm

Xp or Y


The DNA of human chromosomes disastrous consequences!!!

# base pairs

# genes

# base pairs

# genes


The cellular life disastrous consequences!!!cycle

Elements of mitosis:

cell growth; chromosome duplication

chromosome segregation

cell growth; chromosome duplication

chromosomes decondensed

chromosome segregation

chromosomes condensed

repeat


Chromosome replication a reminder
Chromosome replication – a reminder disastrous consequences!!!

  • Mechanism of DNA synthesis ensure that each double stranded DNA gets copied only once.

  • The products of DNA replication have one new DNA strand and one old one (semi-conservative replication)


Chromosome structure a reminder
Chromosome structure – a reminder disastrous consequences!!!

chromosome structure during cell growth & chromosome replication (decondensed)

held together at the centromere

sister chromatids; double-stranded DNA copies of the SAME homolog


Mitosis -- making sure each daughter cell gets one copy of each pair of chromosomes

  • Copied chromosomes (sister chromatids) stay joined together at the centromere.

  • Proteins pull the two sister chromatids to opposite poles

  • Each daughter cell gets one copy of each homolog.


Mitosis -- homologous chromosomes each pair of chromosomes

1m

1p

joined at centromere

2 copies 1p

2 copies 1m

2 copies 1m

2 copies 1p

1m

1m

1p

1p

1m

1m

1p

1p

exact copies


Mitosis each pair of chromosomes – following the fate of CFTR

CFTR-

CFTR+

2 copies CFTR+

2 copies CFTR-

2 copies CFTR+

2 copies CFTR-

CFTR+

CFTR+

A CFTR heterozygote (CFTR+/CFTR-)

CFTR-

CFTR-

CFTR+

CFTR+

CFTR-

CFTR-


CTCCTCAGGAGTCAGGTGCAC each pair of chromosomes

CTCCACAGGAGTCAGGTGCAC

GTGCACCTGACTCCTGTGGAG

GTGCACCTGACTCCTGAGGAG

A closer look at the chromosomes

Paternal chromosome

Maternal chromosome

Mitosis -- 2 copies of each chromosome at the start


CTCCACAGGAGTCAGGTGCAC each pair of chromosomes

CTCCTCAGGAGTCAGGTGCAC

GTGCACCTGACTCCTGTGGAG

GTGCACCTGACTCCTGAGGAG

A closer look at the chromosomes

DNA strands separate followed by new strand synthesis


CTCCTCAGGAGTCAGGTGCAC each pair of chromosomes

CTCCACAGGAGTCAGGTGCAC

CTCCACAGGAGTCAGGTGCAC

CTCCTCAGGAGTCAGGTGCAC

GTGCACCTGACTCCTGTGGAG

GTGCACCTGACTCCTGTGGAG

GTGCACCTGACTCCTGAGGAG

GTGCACCTGACTCCTGAGGAG

A closer look at the chromosomes

  • Mitosis -- after replication 4 copies

  • Homologs unpaired sister chromatidsjoined by centromere


CTCCTCAGGAGTCAGGTGCAC each pair of chromosomes

CTCCACAGGAGTCAGGTGCAC

CTCCACAGGAGTCAGGTGCAC

CTCCTCAGGAGTCAGGTGCAC

GTGCACCTGACTCCTGTGGAG

GTGCACCTGACTCCTGTGGAG

GTGCACCTGACTCCTGAGGAG

GTGCACCTGACTCCTGAGGAG

A closer look at the chromosomes

Each daughter has a copy of each homolog


Mitosis and the cell cycle each pair of chromosomes


Mitosis vs. Meiosis each pair of chromosomes

- The goal of mitosis is to make more “somatic” cells:

each daughter cell should have the same chromosome set as the parental cell

- The goal of meiosis is to make sperm and eggs:

each daughter cell should have half the number of chromosome sets as the parental cell


Meiosis: the formation of gametes each pair of chromosomes

  • The challenge:

  • ensuring that homologues are partitioned to separate gametes

  • The solution:

  • Hold homologous chromosomes together by crossing over

  • target homologues to oppositepoles of the cell…

  • then separate the homologues


ad