Homework 2 2
This presentation is the property of its rightful owner.
Sponsored Links
1 / 12

Homework 2.2 PowerPoint PPT Presentation


  • 83 Views
  • Uploaded on
  • Presentation posted in: General

Homework 2.2. What is your understanding of Bioinformatics? Which fields or problems of Bioinformatics are you interest in?. Homework 2.3. Search and download the mRNA and Protein sequences of gene TP53 ( human&mouse ) from NCBI Analyze the number of A, T, C , G, respectively

Download Presentation

Homework 2.2

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Homework 2 2

Homework 2.2

  • What is your understanding of Bioinformatics?

  • Which fields or problems of Bioinformatics are you interest in?


Homework 2 3

Homework 2.3

  • Search and download the mRNA and Protein sequences of gene TP53 (human&mouse) from NCBI

  • Analyze the number of A, T, C, G, respectively

  • Analyze the number of different codons, respectively


Homework 3 1

Homework 3.1

  • Search and download the mRNA and Protein sequences of gene TP53(human&mouse) from NCBI

  • Alignment the mRNA sequences using Pairwise Sequence Alignment in:

  • Alignment the Protein sequences using Pairwise Sequence Alignment in:

    http://www.ebi.ac.uk/Tools/psa/

  • Compare the results of Global Alignment and Local Alignment


Homework 3 2

Homework 3.2

  • Make gene prediction of the provided sequence using more than one approaches, and compare the prediction results.


Homework 3 21

Homework 3.2

>mgutLn1_U_BL_aaa09a01_b1 Mouse Gut Community PT3 : mgutLn1_U_BL_aaa09a01_b1

GTTAACTATCTCGCCCTGTGGTGGATTCTCATTGAACCGAAGCGGACAGG

ATTCCGGGTGTCGTCGTTGTCGCCGTCGGGGGACTGATACAGCGGGAGGT

CAGTGAAAGCCTTGTCTGCCTGATTGACGCGCTGCCACCTTGATAATGCT

TTGGCCACGAATTCCCGTGGCGATTCCTCCATATTGTCGAATAGACAACT

TGCCGAACCCCTGGAAGATTGCGCTTGCAGTATGTAGGGATATTGACCTG

CAGTTGCACCGGGATTGATCCTGATGCGCTTTACACAGGCTGGAGATACC

CGGAATCTTCCAACGCAAGTGGCGTAATATTGGGTAATCTGCTCTTAGTT

TCAGGTTTTCAGATTAGGGACAACCCCGAATCCCCCCTGGTCTCTGCGGC

GAATCCTCGCAGACTAAGCCACCGAGATGTGTTCGACCTTACATGATTAG

TGCGCTCTTACCCTCGCCGAGGTATATCATGCAAAAAATATGCAATGAAA

AACACTGTTGATGCTATATGATATGACCGCTCTGATGACTCTTTACGAAC

CCCCGAATAGGCGCTGCGCATGGATAACTGGGAAAACATTCTTTCCGTCA

TGCTGTCAGAGTTGCTCCAGAACGTTCGGCCTCGGAACACCGACCACTGT

AACAATGGCTGAGACGCCGAAAACTCCCAAAACAGGAACGTGTCTTAACC

TA


Homework 3 22

Homework 3.2

  • homology-based approaches

    • http://bibiserv.techfak.uni-bielefeld.de/agenda/

  • ab initio

    • Glimmer: http://www.ncbi.nlm.nih.gov/genomes/MICROBES/glimmer_3.cgi

    • GeneMark

      http://exon.gatech.edu/

    • wiki

      http://en.wikipedia.org/wiki/Gene_prediction#Comparative_genomics_approaches


Homework 3 3

Homework 3.3

  • Make Motif prediction of the downloaded protein sequence of human TP53 in homework3.1 using more than one approaches, and compare the prediction results.

  • Find the Motifs from last step in protein sequences of mouse TP53 by yourself. (The Motif maybe not in protein of mouse TP53)


Homework 3 4

Homework 3.4

  • Provide one explanation of why an arbitrarily composed DNA sequence generally does not have the barcode properties of genomic DNA sequences?

  • Run the barcode server at http://csbl1.bmb.uga.edu/Barcode/Barcode.html on the DNAseq of Escherichia coli. What information can you derive from the barcode image of the sequence?


Homework 4 1

Homework 4.1

  • Find a reputable structure prediction server and make a tertiary structure prediction of the following sequence.

  • wiki:http://en.wikipedia.org/wiki/List_of_protein_structure_prediction_software

FVFQQSEKFAKVENQYQLLKLETNEFQQLQSKISLISEKLESTESILQEATSSMSLMTQFEQEVSNLQDIMHDIQNNEEVLTQRMQSLNEKFQNITDFWKRSLEEMNINTDIFKSEAKHIHSQVTVQINSAEQEIKLLTERLKDLEDSTLRNIRTVKRQEEEDLLRVEEQLGSDTKAIEKLEEEQHALFARDEDLTNKLSDYEPKVEECKTHLPTIESAIHSVLRVSQDLIETEKKMEDLTMQMFNMEDDMLKAVSEIMEMQKTLEGIQYDNSILKMQNELDILKEKVHDFIAYSSTGEKGTLKEYNIENKGIGGDF


Homework 4 2

Homework 4.2

  • Give a detailed report on known functions, structures, etc on a protein family of Pfam that starts with “A”


Homework 4 21

Homework 4.2

  • Write a search report on a specific protein, say cpiB, based on your search results against GO database http://www.geneontology.org/


Homework 5 1

Homework 5.1

  • Find one popular program for prediction of co-expressed genes based on microarray expression data on the Internet. Explain its basic idea.

  • Qserver:

    http://csbl.bmb.uga.edu/publications/materials/ffzhou/QServer/


  • Login