slide1
Download
Skip this Video
Download Presentation
Session 2 Non-COI Candidate regions John Taylor Tom Bruns Sung-Oui Suh François Lutzoni

Loading in 2 Seconds...

play fullscreen
1 / 25

Session 2 Non-COI Candidate regions John Taylor Tom Bruns Sung-Oui Suh François Lutzoni - PowerPoint PPT Presentation


  • 81 Views
  • Uploaded on

Session 2 Non-COI Candidate regions John Taylor Tom Bruns Sung-Oui Suh François Lutzoni Dirk Redecker Todd DeSantis Teun Boekhout Barbara Robbertse Irina Druzhinina. Fungal Barcoding. John W. Taylor University of California Berkeley, USA. Barcoding fungi is a great idea.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Session 2 Non-COI Candidate regions John Taylor Tom Bruns Sung-Oui Suh François Lutzoni' - mariko


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1

Session 2

Non-COI Candidate regions

John Taylor

Tom Bruns

Sung-Oui Suh

François Lutzoni

Dirk Redecker

Todd DeSantis

Teun Boekhout

Barbara Robbertse

Irina Druzhinina

slide2

Fungal Barcoding

John W. Taylor

University of California

Berkeley, USA

slide3

Barcoding fungi is a great idea.

The potential benefits for fungi are huge because most fungi are microscopic and we believe that most are unknown.

Ecology and its applications would benefit tremendously.

http://www.barcode.it/

slide4

Barcoding fungi is a great idea.

The potential benefits for fungi are huge because most fungi are microscopic and we believe that most are unknown.

Ecology and its applications would benefit tremendously.

http://www.barcode.it/

slide5

Barcoding fungi is a great idea.

The potential benefits for fungi are huge because most fungi are microscopic and we believe that most are unknown.

Ecology and its applications would benefit tremendously.

http://www.barcode.it/

slide6

Cytochrome Oxidase I

is not the right gene for fungal barcoding.

From the barcoding website:

http://www.dnabarcoding.ca/primer/Primers.html

PRIMERS Overview In order to obtain barcode sequences from such a broad spectrum of animal taxa, researchers require an arsenal of primer sets.

slide7

Cytochrome Oxidase I

is not the right gene for fungal barcoding.

From the barcoding website:

http://www.dnabarcoding.ca/primer/Primers.html

PRIMERS Overview In order to obtain barcode sequences from such a broad spectrum of animal taxa, researchers require an arsenal of primer sets.

slide8

If Cytochrome Oxidase I requires an arsenal of primers, how can it work for any group of organisms?

slide9

Macrobes v. Microbes

Macrobes: Phenotype is available in museums or herbaria, zoos or gardens, and nature. Taxa are well sampled.

Microbes: Phenotype is available in herbaria and culture collections but NOT in nature. Taxa are poorly sampled.

slide10

www.livescience.com

Ward et al. (2005) amplified COI from more than 200 fish

using different combinations of four newly designed primers:

FishF1-50TCAACCAACCACAAAGACATTGGCAC30,

FishF2-50TCGACTAATCATAAAGATATCGGCAC30,

FishR1-50TAGACTTCTGGGTGGCCAAAGAATCA30,

FishR2-50ACTTCAGGGTGACCGAAGAATCAGAA30.

However, there was insufficient product from five species,

necessitating the use of an additional forward primer:

(50ATCTTTGGTGCATGAGCAGGAATAGT30)

slide11

Ward et al. (2005) amplified COI from more than 200 fish

using different combinations of four newly designed primers:

FishF1-50TCAACCAACCACAAAGACATTGGCAC30,

FishF2-50TCGACTAATCATAAAGATATCGGCAC30,

FishR1-50TAGACTTCTGGGTGGCCAAAGAATCA30,

FishR2-50ACTTCAGGGTGACCGAAGAATCAGAA30.

However, there was insufficient product from five species,

necessitating the use of an additional forward primer:

(50ATCTTTGGTGCATGAGCAGGAATAGT30)

FIVE PRIMERS FOR FISH

slide15

http://www.botany.utoronto.ca/ResearchLabs/MallochLab/Malloch/Mouldshttp://www.botany.utoronto.ca/ResearchLabs/MallochLab/Malloch/Moulds

Seifert et al. (2007). We tested the performance of PenF1 with

both PenR1 and AspR1 in PCR amplifications using genomic

DNA isolated from ten species of the family Trichocomaceae,

PCR amplications using PenF1 and PenR1 were sporadically

successful, whereas amplications using AspR1 had a 100%

success rate.

Aspergillus and Penicillium subgenus Penicillium are closer

relatives than either is to Penicillium subgenus Biverticillium.

slide19

New

Fungi

In

Tundra

Soils

Schadt et al. 2003

slide20

New

Fungi

In

Tundra

Soils

Schadt et al. 2003

slide21

New

Fungi

In

Tundra

Soils

rDNA sequences

Schadt et al. 2003

slide23

Session 2

Non-COI Candidate regions

John Taylor

Tom Bruns

Sung-Oui Suh

François Lutzoni

Dirk Redecker

Todd DeSantis

Teun Boekhout

Barbara Robbertse

Irina Druzhinina

slide25

Barcoding Decapods (Crustacea) Costa et al. 2007

Forward primers: LCO1490 Crust F1 and Crust F2 (Costa et al. 2007).

Reverse primer: HCO2198 (Folmer et al. 1994).

ad