MiR159 target : U21_3667 (GAMYB)
This presentation is the property of its rightful owner.
Sponsored Links
1 / 1

miR159 target : U21_3667 (GAMYB) 4/4 ↓ PowerPoint PPT Presentation


  • 77 Views
  • Uploaded on
  • Presentation posted in: General

miR159 target : U21_3667 (GAMYB) 4/4 ↓ GAAGATGGAGCTCCCT T CACTCCAAGATACCG miR156 target : U21_18637 (SPL) 3/4 ↓ CGGACTGTGCTCTCTC T CTTCTGTCAGCTCCG miR164 target : U21_9757 (NAC) 2/3 1/3 ↓ ↓

Download Presentation

miR159 target : U21_3667 (GAMYB) 4/4 ↓

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Mir159 target u21 3667 gamyb 4 4

miR159 target : U21_3667 (GAMYB)

4/4

GAAGATGGAGCTCCCTTCACTCCAAGATACCG

miR156 target : U21_18637 (SPL)

3/4

CGGACTGTGCTCTCTCTCTTCTGTCAGCTCCG

miR164 target : U21_9757 (NAC)

2/3 1/3

↓ ↓

GGCGGCGCACGTGACCTGCTTCTCCAACAACG

Figure S5: Results of RLM-5’RACE for three targets of known miRNAs .

The sequences correspond to the 36 bp TSS of each target, the base in green shows the 5’end position of the corresponding degradome signature. Numbers in red refer the ratio of 5’-RACE clones matching the site indicated by an arrow over the total number of clones sequenced.


  • Login