1 / 44

Breeding and Genetics of Soybean Mosaic Virus Resistance in Soybean

Breeding and Genetics of Soybean Mosaic Virus Resistance in Soybean. Ainong Shi Syngenta Seeds Slater, IA USA. Pengyin Chen University of Arkansas Fayetteville, AR USA. Soybean Mosaic Virus (SMV). Most destructive viral disease in soybean

mandek
Download Presentation

Breeding and Genetics of Soybean Mosaic Virus Resistance in Soybean

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Breeding and Genetics of Soybean Mosaic Virus Resistance in Soybean Ainong Shi Syngenta Seeds Slater, IA USA Pengyin Chen University of Arkansas Fayetteville, AR USA

  2. Soybean Mosaic Virus (SMV) • Most destructive viral disease in soybean • Symptoms: Resistant (R, symptomless), necrotic (N, necrotic lesions, or stem-tip necrosis), and susceptible (S, mosaic) • Seven strains G1 to G7 identified in U.S.

  3. Genetic resistance is the primary method of controlling • this disease • Three loci, Rsv1, Rsv3, and Rsv4 have been identified and mapped on the molecular linkage group (MLG) F, B2, and D1b, respectively • Nine alleles (Rsv1, Rsv1-t, Rsv1-y, Rsv1-m, Rsv1-k, Rsv1-s, Rsv1-r, Rsv1-n, and Rsv1-h) at Rsv1 locus have been reported R N S R R R G1 G7 G1 G7 G1 G7 PI96983 (Rsv1) L29 (Rsv3) V94-5152 (Rsv4)

  4. Topic • Confirm 2 Genes of Resistance to SMV in J05 Soybean Using SSR Markers • A PCR-based Marker for the Rsv1 Locus Conferring Resistance to SMV • Gene Pyramiding for SMV Resistance Using Molecular Markers • SNP Markers for SMV Resistance

  5. I. Confirm 2 Genes of Resistance to SMV in J05 Soybean Using SSR Markers • J05, a Chinese soybean cultivar • Resistant to all seven SMV strains • Containing Rsv1 and Rsv3 • (Zheng et al. 2006. J. Hered. 97(5):429-437) * Ainong Shi, Pengyin Chen, Dexiao Li, Cuiming Zheng, Anfu Hou, and Bo Zhang. 2008. Genetic confirmation of two independent genes for resistance to soybean mosaic virus in J05 Soybean using SSR markers. J. Heredity 99(6):598–603

  6. Evaluation of SMV Resistance Each genotype: two pots each with 6 plants SMV strains: G1 - G7 Mechanical inoculation at unifoliolate leaf stage

  7. Procedure of this Research Obtaining Segregating Populations Phenotypic Data Genotypic Data Linkage Analysis & Genetic Mapping

  8. F2 population and F2:3 Lines (R) (S) J05 x Essex (Rsv1Rsv1Rsv3Rsv3)(rsv1rsv1rsv3 rsv3) F1 (Rsv1rsv1Rsv3rsv3) F2 SMV strain G1 G7 Rsv1 R N Rsv3 S R X G1 3R : 1S (3Rsv1_ : 1rsv1rsv1) F2:3 1R : 2Seg : 1S (1Rsv3Rsv3 : 2Rsv3rsv3 : 1rsv3rsv3) G7

  9. J05 x Essex F2 population SMV strain G1 R S Exp. c2 R-gene -------------------------------------------------- 102 36 3:1 0.087 Rsv1 R = Resistant (symptomless) S = Susceptible (mosaic)

  10. G1-susceptible F2 plants (No Rsv1) G7 F2:3 lines R Seg. S Exp. c2 R-gene -------------------------------------------------------- 10 20 15 1:2:1 0.087 Rsv3 R = Homozygous resistant (Rsv3Rsv3) S = Homozygous susceptible (rsv3rsv3) Seg. = Segregating (Rsv3rsv3) SMV strain G1 G7 Rsv1 R N Rsv3 S R

  11. Genetic map of the Rsv1 region 59.60 Sat_297 62.79 Sat_229 63.69 Satt114 66.55 Sat_234 68.44 SOYHSP176 68.91 Sat_154 Rsv1 71.41 Satt510 72.97 Sat_317 74.13 Sct_033 MLG F

  12. SSR primer Satt114 for Rsv1 An example P1=J05, P2=Essex, R = resistant, and S = susceptible plants of in the F2 (J05 x Essex)

  13. Satt114 3.8 cM Sat_154 0.5 cM Rsv1 2.3 cM Satt510 A genetic map for the Rsv1 region on MLG F

  14. 93.49 Satt063 Genetic maps of the Rsv3 region 97.92 Satt560 Rsv3 100.10 Sat_424 100.59 Satt726 113.61 Satt687 MLG B2

  15. Polymorphisms among G1-susceptible plants of J05 x Essex F2amplified from Satt726 for Rsv3

  16. Rsv3 1.5 cM Sat_424 0.5 cM Satt726 A genetic map for the Rsv3 region on MLG B2

  17. SUMMARY I • J05 contains two genes, Rsv1 on MLG F and Rsv3 on MLG B2, for resistance to SMV. • Two genetic maps were constructed. Satt114 Rsv3 3.8 cM 1.5 cM Sat_154 0.5 cM Rsv1 Sat_424 2.3 cM 0.5 cM Satt726 Satt510 MLG B2 MLG F

  18. II. A PCR-based Marker for the Rsv1 Locus Conferring Resistance to SWV Ainong Shi, Pengyin Chen, Cuiming Zheng, Anfu Hou, and Bo Zhang. 2008. A PCR-based marker for the Rsv1 Locus conferring resistance to Soybean Mosaic Virus. Crop Sci. 48:262-268.

  19. PCR-based Marker Rsv1-f/r in Rsv1 Locus M 1 2 3 4 5 6 7 8 341 bp DNA fragments amplified from the primer pair Rsv1-f/r (Lane 1 to 8) on 1.3% agrose gel

  20. Screen of Segregating Population R R R R R R R R R R R S R R R R S S S R R R S R R R R R R S S R S R R R Amplification patterns of the marker with the primer pair Rsv1-f/rin the F2 population derived from J05 x Essex on 1.3% agrose gel. R = resistant and S = susceptible plants in the F2

  21. Amplification patterns of the DNA fragments with the SSR primer Satt 114 in the F2 population derived from J05 x Essex on 6% non-denaturing polyacrylamide gel. P1=J05, P2=Essex, R = resistant, and S = susceptible plants in the F2. Lane M is a 100 bp molecular-weight marker.

  22. 59.60 Sat_297 62.79 Sat_229 63.69 Satt114 66.55 Sat_234 68.44 SOYHSP176 68.91 Sat_154 Rsv1 69.11 Rsv1-f/r: 3gG2 71.41 Satt510 72.97 Sat_317 74.13 Sct_033 A genetic map around the 3gG2 gene between Sat_297 at 59.60 cM to Sct_033 at 74.13 cM of the Molecular Linkage Group (MLG) F.

  23. SUMMARY II • A pair of DNA primers Rsv1-f/r was developed from the candidate gene 3gG2 at the Rsv1 locus for SMV resistance • All genotypes contained Rsv1, Rsv1-k, Rsv1-m,, Rsv1-n, Rsv1-r, Rsv1-s, and Rsv1-t produced the Rsv1-f/r fragment, but those carried Rsv1- y did not • The fragment was neither amplified in only Rsv3 containing genotypes or only Rsv4 containing genotypes, nor in the susceptible genotypes

  24. III. Gene Pyramiding for SMV Resistance Using Molecular Markers J05 (Rsv1Rsv1Rsv3Rsv3) V94-5152 (Rsv4Rsv4) x F1 (Rsv1rsv1Rsv3rsv3Rsv4rsv4) x (3Rsv1:1rsv1)(3Rsv3:1rsv3)(3Rsv4:1rsv4) 1/64 Rsv1Rsv1Rsv3Rsv3Rsv4Rsv4 F2:7 F2:5 F2:6 * Ainong Shi, Pengyin Chen, Dexiao Li, Cuiming Zheng, Anfu Hou, and Bo Zhang. 2009. Gene pyramiding of genes of soybean mosaic virus resistance. Molecular Breeding 23(1):113-124

  25. Gore et al. 2002. Genome 45:592-599 Jeong et al. 2002. Crop Sci. 42:265-270 Cregan. 2003. (http://bldg6.arsusda.gov/~pooley/soy/cregan/cregan.htm)

  26. Six Polymorphic Markers between J05(Rsv1+3) and V94-5152(Rsv4) M 1 2 3 4 5 6 7 8 9 10 11 12 Marker Linked Band gene J05 V94-5152 (Rsv1,3) (Rsv4) Satt510+Sat_317 Rsv1 1+0 2+1 Sat_154+Sat_317 Rsv1 1+0 2+1 Satt063 Rsv3 1 2 Satt560 Rsv3 1 2 Satt266 Rsv4 1 2 AI856415 Rsv4 1 2 Satt510+Sat_317 (lane 1 & 2), Sat_154+Sat_317(lane 3 & 4), Satt063 (lane 5 & 6), Satt560 (lane 7 & 8), Satt266 (lane 9 & 10), and AI856415 (lane 11 & 12). Lane M is a 100 bp DNA molecular ladder.

  27. Sat_317 • Rsv1 • Satt510 • Satt063 (Rsv3) • Satt266 (Rsv4) PCR products amplified from 30 F2:4 plants of J05 x V94-5152 and two parents

  28. Polymorphism of Six SSR Markers in Five F2:3 Plants Derived from J05 x V94-5152 1 = same PCR fragment as in J05, 2 = same PCR fragment as in V94-5152, and 1+2 = both of J05 and V94-5152.

  29. SUMMARY III • Two SSR markers (Sat_154 and Satt510) and one gene-specific marker (Rsv1-f/r) were used for selecting plants containing Rsv1; Satt560 and Satt063 for Rsv3; and Satt266, AI856415, and AI856415-g for Rsv4. • Five F4:5 lines were homozygous for all eight marker alleles and presumably carry all three SMV resistance genes that would potentially provide multiple and durable resistance to SMV.

  30. IV. Development of a Multiplex SNP Assay for Soybean Mosaic Virus Resistance Ainong Shi, Pengyin Chen, Richard Vierling, Innan Cervantes, and Ehsan Shakiba. 2009. Development of multiplex SNP assays for selection of soybean mosaic virus resistance genes in soybean. World Soybean Research Conference VIII, August 10-15, 2009, Beijing, China.

  31. SNP Discovery Essex ACCCTGCACTGCACTTCAAAT PI 96983 ACCCTGCACTTCACTTCAAAT Marshall ACCCTGCACTTCACTTCAAAT Ogden ACCCTGCACTTCACTTCAAAT Essex PI 96983 G T Marshall Ogden T T

  32. Content • Development of allele-specific SNP markers for 3gG2 (Rsv1) • Selection of allele-linked SNP markers for Rsv3, and Rsv4 • Selection of SNP markers from soybean MLGs

  33. 1. Develop Allele-specific SNP Marker for 3gG2 (Rsv1) 3gG2 is the resistance allele at Rsv1 locus and the gene has been cloned and sequenced (Hayes et al. 2004). The sequence of 3gG2 was deposited in GenBank with the accession AY518517. AAAGAAACATACACTCTAGCAGCAGGCACTAATGAAAATAGAGCACATTTTAAGGGAAGTAAGATGGTAG AGAAAGTAGTGAATGCTAGAAAATCAGGTGTGAATCAAATGGACAGAGAAACCAAAGCAAAAGCTTTCAA ...................................................................... ...................................................................... AATTAAACGTTTTAAAAAATACTAGTTAAACAATATGTCTAAAAATATTAAAAATTACTAAGAAACTATT AAAAATACTAGTTAAACAATTTATAGTGCCTTAAGATAATTTCTTCCTTTATAACTATTTAAATAACTAA TTTTTAATAAATAATAATTTTTGTATACTATTTTTACTCATAAAATTAAAACAAACAAGTGTTGGTTAAT ATCCCAAGAGGTACCCTCAGCAGAATCATAGCCACGCATTAATTCATGAAATACAGCTGTTAAAGTTTGT CTTGTTGGGAAGACTCAACAGATATTGGTTGACTCAATCTTAATTAAAGCCATCCTTCATAAAATTGCCT ...................................................................... ...................................................................... ATATTTAACAGATGAATTTTGTTCCCAATTTTTTTTTTATAAAGAATTGTCGTCTAAAAAAGTGTTTATT TCATTTTTCTTTTATTGCAAAGCTTTGAAATTGTTAAATGCGATTTTAGGCCCTAAATTAAATCTAACTA GAAGAGCTC 3gG2 – AY518517

  34. Procedure for 3gG2-specific SNP markers 3gG2 Gene Sequence Primer Design PCR Sequencing PCR Products Multiple Sequence Alignment SNP Discovery SNP Validation SNP Genotyping

  35. 3gG2-AY518517 Tool: Primer-BLAST Primer design 3gG2-f1: TCAGCAGAATCATAGCCACG 3gG2-r1: CCAACACCACTTGCATTTTG (CAAAATGCAAGTGGTGTTGG) PCR PCR Product Sequencing

  36. Multiple Sequence Alignment - Tool - BioEdit

  37. SNP Validation and Genotyping by Sequenom An example Rsv1:[TT][CC] Rsv1-y:[GG][CC] [GT][CC]

  38. 2. Identify Allele-linked SNP Markers for Rsv3 and Rsv4 A519 0.8 CM Rsv3 AW307114A 3.3 CM Rsv4

  39. 3. Select SNP Markers from Soybean MLGs SNP markers from the Soybean Linkage Map – 2006 (http://bfgl.anri.barc.usda.gov/soybean/index.html)

  40. SNP genotyping in Soybean by Sequenom An example

  41. SNP Genotyping in J05 x Essex F2 population • J05 contains two SMV resistance genes Rsv1 and Rsv3 • Rsv1 in J05 is co-segregated with the SNP marker 3gG2snp, unlinked to SNP A519snp and AW307114snp1 • Rsv3 in J05 is co-segregated with SNP A519snp and unlinked to AW307114snp1

  42. SUMMARY IV • 2 SNP markers were identified from the 3gG2 gene at Rsv1 locus • 4 SNPs near Rsv1, 5 near Rsv3, and 5 near Rsv4 were validated • The inheritance mode in two F2 populations • (J05 x Essex and Jindou1 x Essex) were tested by the SNP assay and verified these SNP markers were useful in idenfication and selection of SMV resistance genes

  43. ACKNOWLEDGEMENTS University of Arkansas: Dr. Pengyin Chen, Dr. Rose Gergerich, Dr. Cuiming Zheng, Dr. Bo Zhang, Dr. Anfu Hou, Dr. Tetsuaki Ishabahi, Dexiao, Ehsan, Innan, Justin, Caroline, Tina, Leandro, Andrew, Liliana, Julieta, Xiaoyu, Luciano, Moldir, Michael, Mioko, Takuro, Yoko, and Bryan. ICIA and Purdue University: Dr. Rick Vierling, Larry Svajgr, Alan Galbreth, Pam Hogue, Karan Miller, and Rachael Sondeno

  44. Thank you! Personal web site http://www.switch-grass.net

More Related