Pairwise Sequence Alignment
1 / 50

Pairwise Sequence Alignment - PowerPoint PPT Presentation

  • Uploaded on
  • Presentation posted in: General

Pairwise Sequence Alignment. WHAT?. WHAT?. Given any two sequences (DNA or protein) Seq 1: CATATTGCAGTGGTCCCGCGTCAGGCT S eq 2: TAAATTGCGTGGTCGCACTGCACGCT we are interested to know to what extent they are similar?. CATATTGCAGTGGTCCCGCGTCAGGCT TAAATTGCGT-GGTCGCACTGCACGCT. WHY?.

I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.

Download Presentation

Pairwise Sequence Alignment

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.

- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript

Pairwise sequence alignment

Pairwise Sequence Alignment

Pairwise sequence alignment


Pairwise sequence alignment


  • Given any two sequences (DNA or protein)

    Seq 1:


    Seq 2:


    we are interested to know to what extent they are similar?



Pairwise sequence alignment


Pairwise sequence alignment

  • Discover new function

  • Study evolution

  • Find crucial features within a sequence

  • Identify cause of diseases

Discover function

Discover function

  • Sequences that are similar probably have the same function

Study evolution

Study evolution

If two sequences from different organisms are similar , they may have a common ancestor

Find crucial features

Find crucial features

  • Regions in the sequences that are strongly conserved between different sequences can indicate their functional importance

Conservation of the IGFALS (Insulin-like growth factor) Between human and mouse.



Identify cause of disease

Identify cause of disease

  • Comparison of sequences between individuals can detect changes that are related to diseases

Sickle cell anemia

Sickle Cell Anemia

  • Due to 1 swapping an A for a T, causing inserted amino acid to be valine instead of glutamine in hemoglobin

Image source:

What makes sequences different

What makes sequences different?

Sequence modifications

Indel (replication slippage)





Sequence Modifications

  • Three types of changes

    • Substitution (point mutation)

    • Insertion

    • Deletion


How do we quantitate similarity

How do we quantitate similarity?

Scoring similarity

Scoring Similarity

  • Assume independent mutation model

    • Each site considered separately

  • Score at each site

    • Positive if the same

    • Negative if different

  • Sum to make final score

    • Can be positive or negative

    • Significance depends on sequence length


Substitutions only not including indels

Total score +4

A weak match

Substitutions Onlynot including indels

  • Sequences compared base-by-base

  • Count the number of matches and mismatches

  • Matches score +2, Mismatches score -1


9 matches+18

14 mismatches-14

Including indels

Total score +24

A strong match

Including Indels

  • Create an ‘alignment’

    • Count matches within alignment

    • Required if sequences are different length


17 matches+34

2 mismatches- 2

8 indels- 8

Choosing an alignment





Choosing an Alignment

  • Many different alignments are possible

    • Should consider all possible

    • Take the best score found

    • There may be more than one best alignment

Why is it hard

Why is it hard ?

Alignment (without gaps) requires an algorithm that performs a number of

comparisons roughly proportional to the square of the average sequence length.

If we include gaps the number of comparisons becomes astronomical

Algorithms for pairwise alignments

Algorithms for pairwise alignments

  • Dot Plots – Gibbs and McIntyre

  • Dynamic Programming :

    Local alignment : Smith- Waterman

    Global alignment :Needelman-Wunsch

Dot plots

Dot Plots

  • Early method

  • Sequences at top and left

  • Dots indicate matched bases

  • Diagonal series show matched regions



Dynamic programming

Dynamic Programming

  • A method for reducing a complex problem

  • to a set of identical sub-problems

  • The best solution to one sub-problem is independent from the best solution to the other sub-problem

Dynamic programming1

Dynamic Programming

  • A method for reducing a complex problem

  • to a set of identical sub-problems

  • The best solution to one sub-problem is independent from the best solution to the other sub-problem

What does it mean

what does it mean?

If a path from X→Z passes through Y, the best path from X→Y is independent of the best path from Y→Z



Sequences: A = ACGCTG, B = CATGT

























Score of best alignment between AC and CATG

…between ACG and CATG



…between AC and CATGT

Calculate score between ACG and CATGT




Sequences: A = ACGCTG, B = CATGT

Match:+2, Other:-1

Needleman wunsch example

Needleman-Wunsch Example

Align the next

letter in the


Insertion in the

first sequence





Insertion in the

Second sequence



Needleman wunsch example1

-1 from before plus -1 for mismatch of G against T-2

2 from before plus -1 for mismatch of – against T1

-2 from before plus -1 for mismatch of G against –-3

Cell gets highest score of -2,1,-31


Needleman-Wunsch Example




Sequences: A = ACGCTG, B = CATGT

Needleman wunsch example2

Needleman-Wunsch Example




Sequences: A = ACGCTG, B = CATGT

Pairwise sequence alignment



Pairwise sequence alignment



Pairwise sequence alignment



Pairwise sequence alignment



Pairwise sequence alignment



Pairwise sequence alignment



Pairwise sequence alignment





Pairwise sequence alignment



Pairwise sequence alignment



Pairwise sequence alignment



Pairwise sequence alignment



Needleman wunsch alignment


Needleman-Wunsch Alignment

  • Global alignment between sequences

    • Compare entire sequence against another

  • Create scoring table

    • Sequence A across top, B down left

  • Cell at column i and row j contains the score of best alignment between the first i elements of A and the first j elements of B

    • Global alignment score is bottom right cell

Local alignment smith waterman

Local AlignmentSmith-Waterman

  • Best score for aligning part of sequences

    • Often beats global alignment score

Global Alignment



Local Alignment



Global vs local alignment

Global vs. Local alignment





Global alignment:



Local alignment:

Pairwise sequence alignment

Global vs. Local alignment

Alignment of two Genomic sequences

>Human DNA


>Mouse DNA


Pairwise sequence alignment

Global vs. Local alignment

Alignment of two Genomic sequences

Global Alignment



****** ***** * *** * ****** ***





Local Alignment

Pairwise sequence alignment

Global vs. Local alignment

Alignment of two Genomic DNA and mRNA

>Human DNA


>Human mRNA


Pairwise sequence alignment

Global vs. Local alignment

Alignment of two Genomic DNA and mRNA

Global Alignment

DNA: CATGCGACTGACcgacgtcgatcgatacgactagctagcATCGATCATA


************ **********





Local Alignment

  • Login