320 likes | 422 Views
This chapter provides an overview of key developments in biotechnology, focusing on DNA sequencing, recombinant DNA technology, and gene cloning. It details how the sequencing of the human genome was achieved by 2007 and discusses the process of combining nucleotide sequences from different sources to create recombinant DNA. The cloning of DNA using bacterial plasmids is illustrated, covering methods to produce multiple copies of genes and their applications in various fields, including medicine and agriculture. Techniques such as PCR and gel electrophoresis are also highlighted.
E N D
Chapter 20 Biotechnology
Overview: The DNA Toolbox • Sequencing of the human genome was completed by 2007 • DNA sequencing has depended on advances in technology, starting with making recombinant DNA • In recombinant DNA, nucleotide sequences from two different sources, often two species, are combined in vitro into the same DNA molecule
DNA Cloning and Its Applications: A Preview • Most methods for cloning pieces of DNA in the laboratory share general features, such as the use of bacteria and their plasmids • Plasmids are small circular DNA molecules that replicate separately from the bacterial chromosome • Cloned genes are useful for making copies of a particular gene and producing a protein product
Gene cloning involves using bacteria to make multiple copies of a gene • Foreign DNA is inserted into a plasmid, and the recombinant plasmid is inserted into a bacterial cell • Reproduction in the bacterial cell results in cloning of the plasmid including the foreign DNA • This results in the production of multiple copies of a single gene
Fig. 20-2 Cell containing geneof interest Bacterium 1 Gene inserted intoplasmid Bacterialchromosome Plasmid Gene ofinterest RecombinantDNA (plasmid) DNA of chromosome 2 Plasmid put intobacterial cell Recombinantbacterium 3 Host cell grown in cultureto form a clone of cellscontaining the “cloned”gene of interest Gene ofInterest Protein expressedby gene of interest Copies of gene Protein harvested Basic research andvarious applications 4 Basicresearchon protein Basicresearchon gene Gene used to alter bacteria for cleaning up toxic waste Gene for pest resistance inserted into plants Protein dissolvesblood clots in heartattack therapy Human growth hor-mone treats stuntedgrowth
Using Restriction Enzymes to Make Recombinant DNA • Bacterial restriction enzymes cut DNA molecules at specific DNA sequences called restriction sites • A restriction enzyme usually makes many cuts, yielding restriction fragments • The most useful restriction enzymes cut DNA in a staggered way, producing fragments with “sticky ends” that bond with complementary sticky ends of other fragments Animation: Restriction Enzymes
DNA ligase is an enzyme that seals the bonds between restriction fragments
Fig. 20-3-3 Restriction site 5 3 3 5 DNA Restriction enzymecuts sugar-phosphatebackbones. 1 Sticky end DNA fragment addedfrom another moleculecut by same enzyme.Base pairing occurs. 2 One possible combination DNA ligaseseals strands. 3 Recombinant DNA molecule
A probe can be synthesized that is complementary to the gene of interest • For example, if the desired gene is – Then we would synthesize this probe … … 5 G G C T A A C T T A G C 3 C C G A T T G A A T C G 5 3
The DNA probe can be used to screen a large number of clones simultaneously for the gene of interest • Once identified, the clone carrying the gene of interest can be cultured
Fig. 20-7 • TECHNIQUE Radioactivelylabeled probemolecules ProbeDNA Gene ofinterest Multiwell platesholding library clones Single-strandedDNA from cell Film Nylon membrane Nylonmembrane Location ofDNA with thecomplementarysequence
Expressing Cloned Eukaryotic Genes • After a gene has been cloned, its protein product can be produced in larger amounts for research • Cloned genes can be expressed as protein in either bacterial or eukaryotic cells
Amplifying DNA in Vitro: The Polymerase Chain Reaction (PCR) • The polymerase chain reaction, PCR, can produce many copies of a specific target segment of DNA • A three-step cycle—heating, cooling, and replication—brings about a chain reaction that produces an exponentially growing population of identical DNA molecules
Fig. 20-8 3 5 TECHNIQUE Targetsequence 3 5 Genomic DNA 1 5 3 Denaturation 5 3 2 Annealing Cycle 1yields 2 molecules Primers 3 Extension Newnucleo-tides Cycle 2yields 4 molecules Cycle 3yields 8 molecules;2 molecules(in whiteboxes)match targetsequence
Gel Electrophoresis and Southern Blotting • One indirect method of rapidly analyzing and comparing genomes is gel electrophoresis • This technique uses a gel as a molecular sieve to separate nucleic acids or proteins by size • A current is applied that causes charged molecules to move through the gel • Molecules are sorted into “bands” by their size Video: Biotechnology Lab
Fig. 20-9 TECHNIQUE Powersource Mixture ofDNA mol-ecules ofdifferentsizes – Cathode Anode + Gel 1 Powersource – + Longermolecules 2 Shortermolecules RESULTS
In restriction fragment analysis, DNA fragments produced by restriction enzyme digestion of a DNA molecule are sorted by gel electrophoresis • Restriction fragment analysis is useful for comparing two different DNA molecules, such as two alleles for a gene • The procedure is also used to prepare pure samples of individual fragments
Fig. 20-10 Normal -globin allele Normalallele Sickle-cellallele 175 bp Large fragment 201 bp DdeI DdeI DdeI DdeI Largefragment Sickle-cell mutant -globin allele 376 bp 201 bp175 bp Large fragment 376 bp DdeI DdeI DdeI (a) DdeI restriction sites in normal and sickle-cell alleles of -globin gene (b) Electrophoresis of restriction fragments from normal and sickle-cell alleles
Reverse transcriptase-polymerase chain reaction (RT-PCR) is quicker and more sensitive • Reverse transcriptase is added to mRNA to make cDNA, which serves as a template for PCR amplification of the gene of interest • The products are run on a gel and the mRNA of interest identified
Fig. 20-13 TECHNIQUE 1 cDNA synthesis mRNAs cDNAs Primers 2 PCR amplification -globingene 3 Gel electrophoresis Embryonic stages RESULTS 1 2 3 4 5 6
In situ hybridization uses fluorescent dyes attached to probes to identify the location of specific mRNAs in place in the intact organism
Fig. 20-14 50 µm
Fig. 20-18 TECHNIQUE Mammarycell donor Egg celldonor 2 1 Egg cellfrom ovary Nucleusremoved Cells fused 3 Culturedmammary cells 3 Nucleus frommammary cell Grown inculture 4 Early embryo Implantedin uterusof a thirdsheep 5 Surrogatemother Embryonicdevelopment 6 Lamb (“Dolly”)genetically identical tomammary cell donor RESULTS
Stem Cells of Animals • A stem cell is a relatively unspecialized cell that can reproduce itself indefinitely and differentiate into specialized cells of one or more types • Stem cells isolated from early embryos at the blastocyst stage are called embryonic stem cells; these are able to differentiate into all cell types • The adult body also has stem cells, which replace nonreproducing specialized cells
Fig. 20-20 Embryonic stem cells Adult stem cells From bone marrowin this example Early human embryoat blastocyst stage(mammalian equiva-lent of blastula) Cells generatingall embryoniccell types Cells generatingsome cell types Culturedstem cells Differentcultureconditions Differenttypes ofdifferentiatedcells Blood cells Nerve cells Liver cells
Fig. 20-24 (a) This photo shows EarlWashington just before his release in 2001,after 17 years in prison. Source of sample STRmarker 1 STRmarker 2 STRmarker 3 Semen on victim 17, 19 13, 16 12, 12 Earl Washington 16, 18 14, 15 11, 12 17, 19 13, 16 12, 12 Kenneth Tinsley (b) These and other STR data exonerated Washington andled Tinsley to plead guilty to the murder.
Environmental Cleanup • Genetic engineering can be used to modify the metabolism of microorganisms • Some modified microorganisms can be used to extract minerals from the environment or degrade potentially toxic waste materials • Biofuels make use of crops such as corn, soybeans, and cassava to replace fossil fuels
Most public concern about possible hazards centers on genetically modified (GM) organisms used as food • Some are concerned about the creation of “super weeds” from the transfer of genes from GM crops to their wild relatives
Fig. 20-UN3 DNA fragments from genomic DNAor cDNA or copy of DNA obtainedby PCR Vector Cut by same restriction enzyme,mixed, and ligated Recombinant DNA plasmids
Fig. 20-UN4 TCCATGAATTCTAAAGCGCTTATGAATTCACGGC 5 3 AGGTACTTAAGATTTCGCGAATACTTAAGTGCCG 3 5 Aardvark DNA A G A T T T T C C A A G Plasmid