Biologia molecolare
This presentation is the property of its rightful owner.
Sponsored Links
1 / 36

Biologia Molecolare PowerPoint PPT Presentation


  • 247 Views
  • Uploaded on
  • Presentation posted in: General

Biologia Molecolare. Caratterizzazione di un gene clonato. Il sequenziamento. Sequenziare significa determinare la successione dei monomeri che costituiscono un polimero biologico PROTEINE (sequenza di Aminoacidi) DNA (sequenza di nucleotidi) DNA Genomico cDNA.

Download Presentation

Biologia Molecolare

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Biologia molecolare

Biologia Molecolare

Caratterizzazione di un gene clonato


Il sequenziamento

Il sequenziamento

  • Sequenziare significa determinare la successione dei monomeri che costituiscono un polimero biologico

  • PROTEINE (sequenza di Aminoacidi)

  • DNA (sequenza di nucleotidi)

    • DNA Genomico

    • cDNA


Principi del sequenziamento del dna

Principi del sequenziamento del DNA

  • Molte tecniche di biologia molecolare si basano sulla possibilità di replicare molecole di DNA in vitro:

  • Molecola stampo

  • Nucleotidi trifosfato

  • DNA polimerasi

  • Primers

  • Appropriato buffer di reazione


La replicazione del dna

La replicazione del DNA

I Nucleotidi utilizzati durante questa sintesi non sono nucleotidi normali (cioè nucleosidi-fosfato) ma sono nucleosidi trifosfato.

Questi legami fosfato sono legami ad alta energia, la loro rottura e la liberazione del pirofosfato fornisce energia più che sufficiente per la generazione del nuovo legame covalente tra un nucleotide e un altro


Metodo di sanger

Metodo di Sanger


Metodo di sanger1

Metodo di Sanger


Sequenziamento automatico

Sequenziamento automatico

  • Stesso principio del metodo di Sanger

  • Il primer o i ddNTP sono marcati con un marcatore fuorescente

  • Lettura tramite laser della molecola appena questa esce dal gel

  • Utilizzo di una sola corsia

    • Se si marca il primer?

    • Se si marcano i ddNTP

  • Gel di poliacrillamide o capillare

  • Dato di sequenza acquisito automaticamente e trasferito al computer


Interpretazione automatica del dato

Interpretazione automatica del dato

elettroferogramma


Allungare la sequenza

Allungare la sequenza

  • Con i metodi automatici è possibile ottenere sequenze oltre il migliaio di basi

  • Con l’allungamento della sequenza diminuisce la risoluzione e l’intensità del segnale

  • Aumento probabilità che una struttura secondaria termini la sintesi

  • L’affidabilità diminuisce allontanandosi dal primer


Walking

Walking


Sequenziamento shotgun

Sequenziamento shotgun

  • Per sequenziare un frammento lungo la migliore stratgia è quella di dividerlo in framenti più piccoli.

  • Il DNA può essere frammentato e clonato in una librerie M13 o in plasmidi.

  • La libreria deve contenere frammenti parzialmente sovrapposti

  • Dalla libreria si prelevano cloni a caso e si sequenziano


Sequenziamento shotgun1

Sequenziamento shotgun


Diminuzione della produttivit

Diminuzione della produttività

  • Una accurata determinazione del 90% della sequenza può essere ottenuta molto rapidamente

  • Per ottenere un ulteriore 9% sarà necessario un tempo paragonabile a quello utilizzato per ottenere il 90%

  • Una quantità simile di lavoro sarà necessaria per ottenere un ulteriore 0,9%


Il flusso dell informazione genica

Il flusso dell’informazione genica

Retrotrascrizione

Trascrizione

Traduzione

Il dogma centrale della biologia

  • L’informazione genica è contenuta nel DNA

  • Questa informazione è perpetuata nelle generazioni future tramite il processo semiconservativo chiamato duplicazione del DNA

  • L’espressione della informazione genica è invece un processo che passa attraverso un intermediario transitorio: l’RNA messaggero. Questa molecola è sintetizzata sulla base di uno STAMPO sul DNA e l’informazione in esso contenuta serve per dirigere la sintesi di proteine.

  • L’informazione passa (quasi) sempre dal DNA all’RNA e da questo alle proteine.

Mantenimento dell’informazione

Trasferimento dell’informazione

Ruolo funzionale

DNA

RNA

Proteina

Informazione contenuta nella sequenza

Informazione contenuta nella sequenza e nella quantità

Informazione contenuta nella struttura e nella quantità

Effettuata da alcuni virus a RNA chiamati retrovirus


Il dna natura ed informazione

IL DNA: natura ed informazione

Contenuto informativo del DNA

La struttura del DNA è costante. Il DNA è sempre una doppia elica INDIPENDENTEMENTE dalla sequenza di nucleotidi che lo compone.

L’ossatura di zucchero e fosfato è costante.

La parte variabile, e quindi più informativa, è rappresentata dalla sequenza di BASI AZOTATE.

Per questo motivo, in bioinformatica, l’informazione contenuta nel DNA è rappresentata da una stringa composta da un alternanza 4 caratteri che rappresentano le basi azotate del DNA.

GCGGCGGCGGGCGGGTACTGGCTTCTGGGGCCAGGGGCCAGGGGCGGTGGGCGCCGGGACCGCGGAGCTGAGGAGCGGGGCCCGGCCAGGGCTGGAGACTTTGCGCCCGGGGGCACCGGGGCTGCGCGCGGTCGCACACATCCACCGGCGCGGCTTCCCTCGGCGGCCCGGGCTCCGCTCATCCTGCGGCGGGCGGCGCCGCTCAGGGGCGGGAAGAGGAGGCGGTAGACGCGACCACAGAAGATGTCGGGCCAAACGCTCACGGATCGGATCGCCGCCGCTCAGTACAGCGTTACAGGCTCTGCTGTAGCAAGAGCGGTCTGCAAAGCCACTACTCATGAAGTAATGGGCCCCAAGAAAAAGCACCTGGACTATTTGATCCAGGCTACCAACGAGACCAATGTTAATATTCCTCAGATGGCCGACACTCTCTTTGAGCGGGCAACAAACAGTAGCTGGGTGGTTGTGTTTAAGGCTTTAGTGACAACACATCATCTCATGGTGCATGGAAATGAGAGATTTATTCAATATTTGGCTTCTAGAAATACACTATTCAATCTCAGCAATTTTTTGGACAAAAGTGGATCCCATGGTTATGATATGTCTACCTTCATAA


I geni

I Geni

  • Il gene è l'unità ereditaria e funzionale degli organismi viventi.

  • La maggior parte dei geni codifica proteine, che sono le macromolecole maggiormente coinvolte nei processi biochimici e metabolici della cellula.

  • Altri geni non codificano proteine, ma producono RNA non codificante, che può giocare un ruolo fondamentale nella sintesi delle proteine e nell'espressione genica (La trascrizione del DNA in RNA e la traduzione dell'RNA in proteina).

  • Parte del contenuto dei geni non viene trascritto, ma può coordinare la stessa espressione genica.

  • Tra queste regioni figurano i promotori, i terminatori e gli introni .


Struttura del gene

Struttura del gene


Non tutti gli esoni codificano

Non tutti gli esoni codificano

  • Gli esoni sono normalmente codificanti, ad eccezione di quelli alle estremità 5' e 3' del gene.

  • Tali esoni prendono il nome di UTR (UnTranslated Region).

  • In questo caso il 5' UTR è costituito da tutto il 1° esone e da parte del 2° esone (regione arancione).

  • La regione codificante è indicata in blu, inizia nel 2° esone e termina nell'ultimo esone.

  • Il 3' UTR è costituito da parte dell'ultimo esone (regione gialla).

Introni

Esoni


I geni1

I Geni

  • Il gene è l’unità ereditaria e funzionale degli organismi viventi; ad esso sono associate molteplici informazioni:

AnalisiFilogenetica

Struttura

Proteina(Funzione)

Sequenze omologhein altri genomi

Gene

Sequenza

Localizzazionegenomica


Le sequenze biologiche

Le sequenze biologiche

  • Le sequenze nucleotidiche vengono rappresentate mediante stringhe su un alfabeto di 4 caratteri (A, C, G, T), nelle quali ciascun carattere rappresenta un singolo nucleotide.

  • Analogamente le sequenze proteiche (o aminoacidiche) vengono rappresentate mediante stringhe su un alfabeto di 20 caratteri, ciascuno dei quali rappresenta un singolo aminoacido.


Lo standard iub iupac

Lo Standard IUB/IUPAC


Biologia molecolare

NCBI

  • NCBI (National Center for Biotechnology Information) è l’istituto americano che ospita GenBank, una delle tre banche dati primarie di sequenze nucleotidiche (http://www.ncbi.nlm.nih.gov).

  • Oltre a GenBank in NCBI sono disponibili numerosi altri Database tra cui:

    • GenPept: Database di sequenze proteiche

    • Gene: Database di geni

    • Pubmed: Database di letteratura biomedica (Abstract, articoli e citazioni)

  • NCBI offre anche svariati strumenti per l’analisi di dati biologici tra cui BLAST, un tool che permette di effettuare ricerche per similarità nei database di sequenze.


Entrez

Entrez

  • I vari database di NCBI sono accessibili mediante un unico motore di ricerca che prende il nome di Entrez:

    http://www.ncbi.nlm.nih.gov/Entrez/index.html


Esempio di ricerca bax 1

Esempio di ricerca: BAX (1)

  • Ricerchiamo i dati relativi al gene BAX utilizzando Entrez:

  • Otterremo i risultati suddivisi per categoria:


Esempio bax 2

Esempio: BAX (2)

  • Nella pagina dei risultati relativi alle sequenze nucleotidiche clicchiamo sul link alla sequenza cercata:

  • A questo punto otterremo la pagina coi risultati (formato GenBank), che andiamo a vedere nel dettaglio nella prossima slide.


Esempio bax 3

Esempio: BAX (3)

Tipo di sequenza

Lunghezza della sequenza

Accession Number

Organismo

Riferimenti bibliografici


Esempio bax 4

Esempio: BAX (4)

Link alla regione codificante

Estremi della CDS

Link alla proteina corrispondente


Esempio bax 5

Esempio: BAX (5)

  • Cliccando su “CDS” otteniamo la regione codificante della sequenza:


Il formato fasta

Il formato FASTA

  • E’ possibile scegliere il formato di visualizzazione della sequenza; scegliamo il formato più utilizzato, il FASTA.

  • E’ anche possibile inviare la sequenza nel formato prescelto direttamente su file (Send to -> File).


Esempio bax 6

Esempio: BAX (6)

  • A questo punto andiamo a visualizzare la proteina codificata cliccando sul link relativo; si aprirà una pagina simile a quella vista per la sequenza nucleotidica (formato GenPept):


Esempio bax 7

Esempio: BAX (7)

  • Facciamo adesso un passo indietro tornando alla schermata di Entrez. Clicchiamo su Gene:


Esempio bax 8

Esempio: BAX (8)

  • Verrà visualizzata una pagina con informazioni dettagliate sul gene:

Informazioni varie sul gene, tassonomia, tipo, breve descrizione

Accession Number della entry di Gene

Nome del gene e specie di appartenenza


Esempio bax 9

Esempio: BAX (9)

  • Scorrendo la pagina si trovano le informazioni strutturali:

Accession number della sequenza del gene

Struttura delle isoforme del gene (in blu la regione non tradotta, in rosso la regione codificante)

Accession numbers dei rispettivi geni (GenBank)

Accession number delle rispettive proteine (GenPept)


Esempio bax 10

Esempio: BAX (10)

  • Informazioni sulla localizzazione genomica

Coordinate posizionali

Cromosoma

BAX e suo orientamento

Geni limitrofi e relativo orientamento


Esempio bax 11

Esempio: BAX (11)

  • In fondo alla pagina troviamo ulteriori inf. :

Pathways: cascate di reazioni all’interno delle quali è coinvolta la proteina codificata

Fenotipo (modo in cui si manifesta la funzione della proteina codificata)

Informazioni generali sulla funzione e sui processi biologici interessati.

Omologhi del gene in altre specie

Sequenze correlate

Varianti del gene


La gene table

La Gene Table

  • E’ possibile scegliere dalla tendina in alto a sinistra, di visualizzare la Gene Table:

  • La Gene Table mostra i confini di esoni ed introni del gene:


  • Login