chapter 13 genetic engineering
Download
Skip this Video
Download Presentation
Chapter 13: Genetic Engineering

Loading in 2 Seconds...

play fullscreen
1 / 58

Chapter 13: Genetic Engineering - PowerPoint PPT Presentation


  • 103 Views
  • Uploaded on

Chapter 13: Genetic Engineering. Modifying offspring’s appearance at the NON-DNA level. Selective Breeding HOW: allowing only those animals with desired characteristics to produce the next generation Pros: t akes advantage of naturally occurring genetic variation in organisms

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Chapter 13: Genetic Engineering' - lilka


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
modifying offspring s appearance at the non dna level
Modifying offspring’s appearance at the NON-DNA level
  • Selective Breeding
    • HOW: allowing only those animals with desired characteristics to produce the next generation
      • Pros: takes advantage of naturally occurring genetic variation in organisms
      • Cons: No guarantee you get what you want
      • EX: Breeding the winners of a horse race
hybrid ization
Hybridization
  • HOW: Crossing organisms of different traits to produce a hardier product
    • Pros: can get “best of both worlds”
    • Cons: not guaranteed you get desired traits
    • EX: A mule is a cross of a horse and a donkey – Sturdy (donkey) and surefooted (horse)
    • EX: Hybrid corn – tastes good and is more resistant to disease.
zebroid
ZEBROID
  • Cross between a zebra and a horse
  • Aka “zebra mule”, “zebrule”, “zorse”
jostaberry
Jostaberry
  • Hybrid between gooseberry and blackcurrant +
broccoflower
Broccoflower
  • Broccoli + cauliflower

+ =

chuman manpanzee
Chuman / Manpanzee
  • Chuman – male chimp, female human
  • Manpanzee- male human, female chimp
  • HYPOTHETICAL SPECIES
  • (not real)
why it doesn t work
Why it doesn’t work
  • Wrong number of chromosomes
  • Sperm cannot penetrate egg
  • Post-zygotic reproductive barriers
    • Even if the egg got fertilized, it wouldn’t be recognized by mother and would spontaneously abort
inbreeding
Inbreeding
  • HOW: Maintaining the present genes by breeding only within the population
    • Pros: Keeps family traits you want
    • Cons: recessive traits showing up that may be lethal or harmful.
    • EX: Pedigree animals
inducing mutations
Inducing mutations
  • How: using radiation & chemicals to alter DNA and force mutations to occur
    • Pros: new phenotypes
    • Concerns: Not a sure bet nor do you know what you are going to get
    • EX: Polyploidy (3N or 4N) plants have resulted from this – larger & hardier
slide12

Selective

Breeding

Hybridization

Inducing

Mutations

Inbreeding

process box 13 1
PROCESS BOX 13-1

What are two similarities between the four methods above?

What are two differences between the four methods above?

MUST BE AT LEAST 4 LINES LONG

modifying an organism directly at the dna level
Modifying an organism directly at the DNA level
  • DNA Technology – science involved in the ability to manipulate genes/DNA
  • Purpose:
    • Cure disease (Cystic Fibrosis)
    • Treat genetic disorders (Hemophilia, diabetes)
    • Improve food crops (better tasting, longer shelf life, fungus resistance…)
    • Improve human life in general
you choose
YOU CHOOSE!
  • Notecards (with pocket glued to notebook)
  • Vocab foldable
the tools
The Tools:
  • DNA Extraction – Chemical procedure to remove DNA
  • Restriction enzymes– molecular scissors that cut DNA at specific nucleotide sequences
  • Gel Electrophoresis– method to analyze fragments of DNA cut by restriction enzymes through a gel made of agarose (molecular sieve)
  • DNA Ligase – molecular glue that puts pieces of DNA together
  • Polymerase Chain Reaction (PCR)- molecular copy machine. Makes millions of copies of DNA/hr
treatment of diseases
Treatment of diseases
  • Several diseases have been “treated” in the past
    • Diabetics—injections of insulin from sheep
      • Problems?
treatment of diseases1
Treatment of Diseases
  • Several diseases have been “treated” in the past
    • Dwarfism– using hormones from pituitaries of cadavers
      • Problems
treatment of diseases2
Treatment of Diseases
  • Several diseases have been “treated” in the past
    • Hemophilia—using blood clotting factors from blood transfusions
      • Problems?
new method of treating diseases
New method of treating diseases
  • Overall Scheme: get bacteria to make what you want, harvest from bacteria
    • Called Recombinant DNA Technology
what are restriction enzymes
What are restriction enzymes?
  • Bacterial enzymes – used to cut bacteriophage DNA (viruses that invade bacteria).
    • Different bacteria make different enzymes
    • Restriction enzymes recognize a specific short nucleotide sequence called a recognition site
      • Palindromes same base pairing forward and backwards
blunt sticky ends
Blunt & Sticky ends
  • Sticky ends – Creates an overhang.
    • EX: EcoRI
  • Blunt Ends- Enzymes that cut at precisely opposite sites without overhangs.
    • EX:SmaI
process box 13 2
PROCESS BOX 13-2
  • Do you think that blunt ends or sticky ends are easier to reconnect? Why?

MUST BE AT LEAST 2 LINES LONG

recombinant dna technology
Recombinant DNA technology
  • Isolate gene of interest from human (or other organism)
    • Cut with restriction enzyme
  • Cut cloning vector (bacterial plasmid or viral DNA)
    • Cut with same restriction enzyme
    • Want a genetic marker present (allows identification)
recombinant dna technology1

Donor Gene

Recombinant DNA technology
  • “Glue” gene of interest onto cloning vector
    • DNA ligase puts them together
    • At this point, you have created a piece of Recombinant DNA
      • Recombinant DNA - DNA with new piece of genetic information on it
recombinant dna technology2
Recombinant DNA technology
  • Cloning vector goes into bacterium
    • Bacteria is called a transgenic organism--organism with foreign DNA incorporated in its genome (genes)
  • Screen for the bacteria that did transform by using genetic marker (antibiotic resistance)
  • Bacteria makes protein from gene of interest
    • Protein is used
process box 13 4
PROCESS BOX 13-4
  • Explain how to make Ms. Lichtenwalner’sMaplePig™ using the five steps of recombinant DNA technology above. Be as specific as possible.

MUST BE AT LEAST 8 LINES LONG

benefits of dna technology
Benefits of DNA technology
  • Pharmaceutical products – insulin, HBCF (human blood clotting factor)
  • Genetically engineered vaccines – to combat viral infections (pathogenic – disease causing)
    • body recognizes foreign proteins, produces antibodies
    • Prevents future illness
benefits of dna technology1
Benefits of DNA technology
  • Increasing agricultural yields –GMO – Genetically modified
    • Insect-resistant plants
    • Disease resistant plants
    • Herbicide resistant plants
    • Increase N fixation
    • Salt tolerant plants
benefits of dna technology2
Benefits of DNA technology
  • Improve quality of produce
    • Slow down the ripening process – ship when un-ripened, to market when ripe
    • Enhance color of produce
    • Reduce hairs or fuzz on produce
    • Increase flavor
    • Frost resistance
negatives of dna technology
Negatives of DNA Technology
  • Food allergies
    • EX: May have peanut products in a non-peanut food and NOT KNOW!
  • FDA does not require that on a label (here in the US)
  • Also, may create “superweeds” that cross pollinate with others & may take over environment
    • Genetic resistance to our ways of chemically removing them
  • Health effects down the road?
process box 13 41
PROCESS BOX 13-4
  • Do you think that the benefits of DNA technology outweigh the negatives of DNA technology? Defend you answer with two examples.

MUST BE AT LEAST 3 LINES LONG

cloning more dna tech
Cloning—more DNA tech
  • What is it?
    • Growing a population of genetically identical cells from a single cell.
  • Landmark year
    • 1997 - Ian Wilmut with Dolly, the cloned sheep
      • First cloned mammal
cloning process
Cloning Process
  • Remove nucleus from egg cell
  • Fuse de-nucleated cell with a body cell from another adult
  • Cells become 2N and then divides
  • Implant embryo in reproductive system of foster mother
process box 13 6
PROCESS BOX 13-6
  • Congress thinks the country has gone to shambles, and they plan to clone George Washington, the “first” (actually 7th) president of the United States. In the space below, outline a plan that explains how George Washington could be cloned.

MUST BE AT LEAST 3 LINES LONG

polymerase chain reaction
Polymerase Chain Reaction
  • Makes many copies of one piece of DNA by repeating replication
dna fingerprinting more dna tech
DNA Fingerprinting—more DNA tech
  • Using cut DNA at specific sites to determine the source of the DNA.
  • Analyzes sections of DNA that have little to no function but vary greatly from one person to the next (called repeats)
  • RFLP analysis – We’ll do this in lab
dna fingerprinting
DNA Fingerprinting
  • RFLP analysis– Restriction fragment length polymorphism. We each have non-coding segments on our DNA.
    • Extract DNA sample from blood or tissues
    • Cut DNA using restriction enzymes. Fragment lengths varies with each person
    • Separate fragments by gel electrophoresis– separates DNA fragments by the # of base pairs (length of the fragment) and charge
dna fingerprinting1
DNA Fingerprinting
  • Place DNA sample into wells in the agarose gel – molecular sieve
  • Run a current through the gel. The DNA (negatively charged) will migrate from (-) to (+)
    • The larger fragments will not migrate that far. The small fragments will go the furthest.
  • Stain gel and bands in a dye or use a radioactive probe to analyze the banding
variable number tandem repeat
Variable Number Tandem Repeat
  • Aka VNTR
  • Small segments of DNA that are repeatedover and over
    • Varies from individual to individual
  • What is the repeat in this sequence?
    • TAACGTAACGTAACGTAACGTAACGTAACG
slide52
Your VNTRs are inherited from your parents

Shown below are the VNTR patterns for Mrs. Nguyen [blue],&

Mr. Nguyen [yellow]

  • Their four children:
    • D1 (the Nguyens\' biological daughter)
    • D2 (Mr. Nguyen\'s step-daughter, child of Mrs. Nguyen and her former husband [red])
    • S1 (the Nguyens\' biological son)
    • S2 (the Nguyens\' adopted son, not biologically related [his parents are light and dark green]).
process box 13 7
PROCESS BOX 13-7
  • Why would you want to compare the “repeats” in junk DNA (which is what we use) instead of comparing the DNA found in a gene such as hair color?

MUST BE AT LEAST 2 LINES LONG

human genome project
Human Genome Project
  • Goal: Sequence all human DNA
    • Completed in 2003
    • Not as “amazing” as hoped
      • We’re too complicated!
gene therapy
Gene Therapy
  • Treatment of a genetic disorder (like cystic fibrosis) by correcting a defective gene that causes a deficiency of an enzyme.
  • Nasal spray that carries normal enzyme gene. Body makes enzyme and patient breathes normally. Regular treatments necessary
  • Has not been proven to be successful in the long term
process box 13 8
PROCESS BOX 13-8
  • S. 107 (111th): Funding DNA Technology Initiative Act of 2009 was introduced on January 6, 2009, in a previous session of Congress, but was not enacted. The goal of this bill was to authorize funding for the Advancing Justice through DNA Technology initiative. The cost of the bill would have been $217,000,000 for two years in a row, and the money spent would…
    • Improve crime laboratories\' capacities to analyze DNA samples in a timely fashion.
    • Ensure that DNA forensic technology is used to its full potential to solve missing persons cases and identify human remains.
    • Protect the innocent.
  • Do you think this bill should have been passed? If so, list two reasons why. If not, list two places the funding should go instead.

MUST BE AT LEAST 4 LINES LONG

ad