Chapter 19: Eukaryotic Genomes: Organization, Regulation & Evolution

1. Chapter 19: Eukaryotic Genomes: Organization, Regulation & Evolution Test corrections – Due Wednesday

2. Chapter 19: Eukaryotic Genomes: Organization, Regulation & Evolution 2 nm DNA double helix Histone tails His- tones 10 nm Histone H1 Linker DNA (“string”) Nucleosome (“bead”) (a) Nucleosomes (10-nm fiber) 30 nm Nucleosome (b) 30-nm fiber Protein scaffold Loops 300 nm Scaffold (c) Looped domains (300-nm fiber) 700 nm 1,400 nm (d) Metaphase chromosome 1. How is chromatin structured on a chromosome?

3. Chapter 19: Eukaryotic Genomes: Organization, Regulation & Evolution Signal NUCLEUS Chromatin Chromatin modification: DNA unpacking involving histone acetylation and DNA demethlation DNA Gene available for transcription Gene Transcription Exon RNA Primary transcript Intron RNA processing Tail mRNA in nucleus Cap Transport to cytoplasm CYTOPLASM mRNA in cytoplasm Degradation of mRNA Translation Polypetide Cleavage Chemical modification Transport to cellular destination Active protein Degradation of protein Degraded protein • How is chromatin structured on a chromosome? • How is gene expression regulated? • DNA level • DNA demethylation • Histone acetylation

4. Chapter 19: Eukaryotic Genomes: Organization, Regulation & Evolution Chromatin changes Transcription RNA processing Translation mRNA degradation Protein processing and degradation Histone tails DNA double helix Amino acids available for chemical modification (a) Histone tails protrude outward from a nucleosome Unacetylated histones Acetylated histones (b) Acetylation of histone tails promotes loose chromatin structure that permits transcription • How is chromatin structured on a chromosome? • How is gene expression regulated? • DNA level • DNA demethylation • 5% of Cytosines have –CH3 • Demethylase removes –CH3 • Histone acetylation

5. Chapter 19: Eukaryotic Genomes: Organization, Regulation & Evolution Signal NUCLEUS Chromatin Chromatin modification: DNA unpacking involving histone acetylation and DNA demethlation DNA Gene available for transcription Gene Transcription Exon RNA Primary transcript Intron RNA processing Tail mRNA in nucleus Cap Transport to cytoplasm CYTOPLASM mRNA in cytoplasm Degradation of mRNA Translation Polypetide Cleavage Chemical modification Transport to cellular destination Active protein Degradation of protein Degraded protein • How is chromatin structured on a chromosome? • How is gene expression regulated? • DNA level • DNA demethylation • Histone acetylation • RNA level • Activation of transcription

6. Poly-A signal sequence Termination region Proximal control elements Enhancer (distal control elements) Exon Intron Intron Exon Exon DNA Downstream Upstream Promoter Transcription Poly-A signal Exon Exon Intron Intron Exon Cleared 3 end of primary transport Primary RNA transcript (pre-mRNA) 5 Chromatin changes RNA processing: Cap and tail added; introns excised and exons spliced together Transcription Intron RNA RNA processing Coding segment mRNA degradation Translation Protein processing and degradation P G P mRNA P Start codon Poly-A tail Stop codon 3 UTR (untranslated region) 5 Cap 5 UTR (untranslated region) Figure 19.5 A eukaryotic gene and its transcript • Proximal and distal control elements farther upstream from promoter • Enhancers or silencers may bind here

7. Distal control element Promoter Activators Activator proteins bind to distal control elements grouped as an enhancer in the DNA. This enhancer has three binding sites. Gene 1 Enhancer TATA box General transcription factors DNA-bending protein A DNA-bending protein brings the bound activators closer to the promoter. Other transcription factors, mediator proteins, and RNA polymerase are nearby. Group of Mediator proteins 2 RNA Polymerase II Chromatin changes The activators bind to certain general transcription factors and mediator proteins, helping them form an active transcription initiation complex on the promoter. 3 Transcription RNA processing RNA Polymerase II mRNA degradation Translation Protein processing and degradation Transcription Initiation complex RNA synthesis Figure 19.6 A model for the action of enhancers and transcription activators Why is this relevant?? Who cares??

8. Promoter Enhancer Albumin gene Control elements Crystallin gene Liver cell nucleus Lens cell nucleus Available activators Available activators Albumin gene not expressed Albumin gene expressed Crystallin gene not expressed Crystallin gene expressed Liver cell Lens cell (b) (a) All somatic cells have the same DNA so… How is cell-specific transcription controlled? • cell-specific activators

9. Chapter 19: Eukaryotic Genomes: Organization, Regulation & Evolution Chromatin changes Transcription RNA processing mRNA degradation Translation Protein processing and degradation Exons DNA Primary RNA transcript RNA splicing or mRNA • How is chromatin structured on a chromosome? • How is gene expression regulated? • DNA level • DNA demethylation • Histone acetylation • RNA level • Activation of transcription • RNA processing • 5’ cap & 3’ poly-A tail • Alternative splicing • 75% of human genes • mRNA transport to cytoplasm • mRNA degradation

10. One strand of each short double- stranded RNA is degraded; the other strand (miRNA) then associates with a complex of proteins. The bound miRNA can base-pair with any target mRNA that contains the complementary sequence. The miRNA-protein complex prevents gene expression either by degrading the target mRNA or by blocking its translation. 1 5 3 4 2 An enzyme called Dicer moves along the double- stranded RNA, cutting it into shorter segments. The micro- RNA (miRNA) precursor folds back on itself, held together by hydrogen bonds. Chromatin changes Transcription RNA processing mRNA degradation Translation Protein processing and degradation Protein complex Dicer Degradation of mRNA OR miRNA Target mRNA Blockage of translation Hydrogen bond Figure 19.9 Regulation of gene expression by microRNAs (miRNAs)

11. Chapter 19: Eukaryotic Genomes: Organization, Regulation & Evolution Signal NUCLEUS Chromatin Chromatin modification: DNA unpacking involving histone acetylation and DNA demethlation DNA Gene available for transcription Gene Transcription Exon RNA Primary transcript Intron RNA processing Tail mRNA in nucleus Cap Transport to cytoplasm CYTOPLASM mRNA in cytoplasm Degradation of mRNA Translation Polypetide Cleavage Chemical modification Transport to cellular destination Active protein Degradation of protein Degraded protein • How is chromatin structured on a chromosome? • How is gene expression regulated? • DNA level • DNA demethylation • Histone acetylation • RNA level • Activation of transcription • RNA processing • mRNA transport to cytoplasm • mRNA degradation • Protein level • Translation • Cleavage • signal peptide • Inactive “-ogen” proteins • Chemical modification – Carbs, lipids • Transport to organelles • Protein degradation

12. Multiple ubiquitin mol- ecules are attached to a protein by enzymes in the cytosol. 2 2 1 Enzymatic components of the proteasome cut the protein into small peptides, which can be further degraded by other enzymes in the cytosol. Chromatin changes The ubiquitin-tagged protein is recognized by a proteasome, which unfolds the protein and sequesters it within a central cavity. Transcription RNA processing Proteasome and ubiquitin to be recycled Ubiquitin mRNA degradation Translation Proteasome Protein processing and degradation Protein fragments (peptides) Protein to be degraded Ubiquinated protein Protein entering a proteasome Figure 19.10 Degradation of a protein by a proteasome

13. Chapter 19: Eukaryotic Genomes: Organization, Regulation & Evolution Proto-oncogene DNA Translocation or transposition: gene moved to new locus, under new controls Point mutation within a control element Point mutation within the gene Gene amplification: multiple copies of the gene Oncogene Oncogene New promoter Normal growth-stimulating protein in excess Hyperactive or degradation- resistant protein Normal growth-stimulating protein in excess Normal growth-stimulating protein in excess • How is chromatin structured on a chromosome? • How is gene expression regulated? • How can proto-oncogenes become oncogenes?

14. Chapter 19: Eukaryotic Genomes: Organization, Regulation & Evolution • How is chromatin structured on a chromosome? • How is gene expression regulated? • How can proto-oncogenes become oncogenes? • How can disruptions of cell growth pathways lead to cancer?

15. Growth factor 1 2 3 1 2 3 5 4 MUTATION (a) Cell cycle–stimulating pathway. Hyperactive Ras protein (product of oncogene) issues signals on its own Ras This pathway is triggered by a growth factor that binds to its receptor in the plasma membrane. The signal is relayed to a G protein called Ras. Like all G proteins, Ras is active when GTP is bound to it. Ras passes the signal to a series of protein kinases. The last kinase activates a transcription activator that turns on one or more genes for proteins that stimulate the cell cycle. If a mutation makes Ras or any other pathway component abnormally active, excessive cell division and cancer may result. 1 G protein GTP 2 3 Ras p p p GTP p p 4 p 5 Protein kinases (phosphorylation cascade) Receptor NUCLEUS Transcription factor (activator) DNA Gene expression Protein that stimulates the cell cycle Protein kinases (b) Cell cycle–inhibiting pathway. In this MUTATION pathway, DNA damage is an intracellular signal that is passed via protein kinases and leads to activation of p53. Activated p53 promotes transcription of the gene for a protein that inhibits the cell cycle. The resulting suppression of cell division ensures that the damaged DNA is not replicated. Mutations causing deficiencies in any pathway component can contribute to the development of cancer. Defective or missing transcription factor, such as p53, cannot activate transcription 1 2 3 UV light Active form of p53 DNA damage in genome DNA Protein that inhibits the cell cycle EFFECTS OF MUTATIONS possibly leading to cancer, can result if the cell cycle is overstimulated, as in (a), or not inhibited when it normally would be, as in (b). (c) Effects of mutations. Increased cell division, Protein overexpressed Protein absent Cell cycle not inhibited Cell cycle overstimulated Increased cell division Figure 19.12 Signaling pathways that regulate cell division

16. Chapter 19: Eukaryotic Genomes: Organization, Regulation & Evolution • How is chromatin structured on a chromosome? • How is gene expression regulated? • How can proto-oncogenes become oncogenes? • How can disruptions of cell growth pathways lead to cancer? • What are the differences between prokaryotic & eukaryotic DNA? Prokaryotic Eukaryotic No introns Introns More mutations Few mutations (proofreading) Circular chromosome Linear chromosomes Not in a nucleus In a nucleus Coupled transcription Separate transcription & translation & translation Mostly coding Mostly “filler”

17. Exons (regions of genes coding for protein, rRNA, tRNA) (1.5%) Repetitive DNA that includes transposable elements and related sequences (44%) Introns and regulatory sequences (24%) Unique noncoding DNA (15%) Repetitive DNA unrelated to transposable elements (about 15%) Alu elements (10%) Simple sequence DNA (3%) Large-segment duplications (5–6%) Figure 19.14 Types of DNA sequences in the human genome • Tandomly repetitive DNA (satellite DNA) – 15% • …GTTACGTTACGTTACGTTACGTTAC… • Found in telomeres & centromeres • Interspersed repetitive DNA – 44% • repeats scattered throughout the genome

18. Chapter 19: Eukaryotic Genomes: Organization, Regulation & Evolution • How is chromatin structured on a chromosome? • How is gene expression regulated? • How can proto-oncogenes become oncogenes? • How can disruptions of cell growth pathways lead to cancer? • What are the differences between prokaryotic & eukaryotic DNA? • How do eukaryotic transposable elements become repetitive?

19. New copy of transposon Transposon DNA of genome Transposon is copied Insertion Mobile transposon (a) Transposon movement (“copy-and-paste” mechanism) New copy of retrotransposon Retrotransposon DNA of genome RNA Insertion Reverse transcriptase (b) Retrotransposon movement Figure 19.16 Movement of eukaryotic transposable elements

20. Figure 19.15 The effect of transposable elements on corn kernel color

21. Chapter 19: Eukaryotic Genomes: Organization, Regulation & Evolution • How is chromatin structured on a chromosome? • How is gene expression regulated? • How can proto-oncogenes become oncogenes? • How can disruptions of cell growth pathways lead to cancer? • What are the differences between prokaryotic & eukaryotic DNA? • How do eukaryotic transposable elements become repetitive? • What are gene families? • - Collection of identical or very similar genes that are clustered or dispersed • throughout the genome

22. DNA RNA transcripts Non-transcribed spacer Transcription unit DNA 18S 28S 5.8S rRNA 5.8S 28S 18S (a) Part of the ribosomal RNA gene family -Globin Heme Hemoglobin -Globin -Globin gene family -Globin gene family Chromosome 11 Chromosome 16      G A   2 1   1 2 Fetus and adult Embryo Adult Embryo Fetus (b) The human -globin and -globin gene families Figure 19.17 Gene families Eukaryotic version of an operon. - controlled by 1 promoter

23. Chapter 19: Eukaryotic Genomes: Organization, Regulation & Evolution • How is chromatin structured on a chromosome? • How is gene expression regulated? • How can proto-oncogenes become oncogenes? • How can disruptions of cell growth pathways lead to cancer? • What are the differences between prokaryotic & eukaryotic DNA? • How do eukaryotic transposable elements become repetitive? • What are gene families? • How do genes get duplicated or deleted?

24. Transposable element Gene Nonsister chromatids Crossover Incorrect pairing of two homologues during meiosis and Figure 19.18 Gene duplication due to unequal crossing over

25. Chapter 19: Eukaryotic Genomes: Organization, Regulation & Evolution • How is chromatin structured on a chromosome? • How is gene expression regulated? • How can proto-oncogenes become oncogenes? • How can disruptions of cell growth pathways lead to cancer? • What are the differences between prokaryotic & eukaryotic DNA? • How do eukaryotic transposable elements become repetitive? • What are gene families? • How do genes get duplicated or deleted? • How did the globin gene family evolve?

26. Ancestral globin gene Duplication of ancestral gene Mutation in both copies   Transposition to different chromosomes Evolutionary time   Further duplications and mutations              A  G 1 2 2 1 -Globin gene family on chromosome 16  -Globin gene family on chromosome 11 Figure 19.19 Evolution of the human -globin and -globin gene families

27. Chapter 19: Eukaryotic Genomes: Organization, Regulation & Evolution • How is chromatin structured on a chromosome? • How is gene expression regulated? • How can proto-oncogenes become oncogenes? • How can disruptions of cell growth pathways lead to cancer? • What are the differences between prokaryotic & eukaryotic DNA? • How do eukaryotic transposable elements become repetitive? • What are gene families? • How do genes get duplicated or deleted? • How did the globin gene family evolve? • How do new genes evolve? • - Exon shuffling

28. EGF EGF EGF EGF Epidermal growth factor gene with multiple EGF exons (green) Exon shuffling Exon duplication F F F F Fibronectin gene with multiple “finger” exons (orange) F EGF K K K Exon shuffling Plasminogen gene with a “kringle” exon (blue) Portions of ancestral genes TPA gene as it exists today Figure 19.20 Evolution of a new gene by exon shuffling