Competitive interaction
Download
1 / 36

Competitive Interaction - PowerPoint PPT Presentation


  • 184 Views
  • Uploaded on
  • Presentation posted in: General

Competitive Interaction. Strategic Management…Action that Creates Value. Pazzo’s. Lynagh’s Pub. Lynagh’s Pub. Competitive Outcomes. Hardball?. Organizational Characteristics. Industry Characteristics. Dethronement of the Leader. Wal-Mart. Market Share. Sears. JC Penney.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha

Download Presentation

Competitive Interaction

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Competitive Interaction


Strategic Management…Action that Creates Value

Pazzo’s

Lynagh’s

Pub

Lynagh’s

Pub


Competitive

Outcomes

Hardball?

Organizational

Characteristics

Industry

Characteristics


Dethronement of the Leader

Wal-Mart

Market

Share

Sears

JC Penney

1950 1960 1970 1980 1990 2000


Dethronement of the Leader

Market

Share

Boeing

McDonnell-

Douglass

Airbus

1950 1960 1970 1980 1990 2000


Dethronement of the Leader

Market

Share

(U.S.)

Nike

Reebok

Adidas

1980 1990 2005


King of the Hill – Fizzy Beverages

Market

Share

Other ?

Coke

Pepsi

1970 1980 1990 2000 2010 2020


Simple Rivalry: Prisoner’s DilemmaWhat to say to police?

Criminal 2

Confess

Keep Quiet

#2 Serves

10 Years in jail

#1 Goes Free

Both Serve

5 Years in Jail

Confess

Criminal 1

#1 Serves

10 Years in Jail

#2 Goes Free

Both Serve

1 Year in Jail

Keep Quiet


Three Stooges

Larry, Moe, and Curley are in a 3-way duel and agree to take turns shooting each other, in that order

Accuracy statistics:

  • Larry hits target 20% of the time

  • Moe hits target 80% of the time

  • Curley hits target 100% of the time

    When the duel starts, what should Larry do?


Competitive Intelligence

A systematic and ethical program for

gathering information about competitors

and general business trends to further your

own company’s goals


Play the Game Differently

New market opportunity

New customers

Develop/leverage new value chain strengths

New strategies/tactics

New “flow” of the game

Why CI?

  • Playing the Game Better

  • Focus on existing competitors/strategic position

  • Leverage value chain strengths

  • Incrementally improve existing strategies/tactics

  • Figuring out what drives behavior

  • Environment/industry drivers

  • Organizational drivers

  • Managerial drivers


Competitor Intelligence Pyramid

Recommendations

Analysis of Data

Sources of Data


Industry experts/analysts

Industry publications

Trade shows/conferences

Advertisements/PR

University research centers

Financial

Court documents/patents

Suppliers/customers

Newspapers

Help wanted ads

Reverse engineering labs

Competitor Intelligence Pyramid


Your Rival’s News-based Competitive Actions July-October 2009

  • Contract with Spike Lee for TV ad

  • Increase R&D budget by 30%

  • Buy warehouse facility near airport in Germany, Re-tool with robotic material handling system

  • License Oracle’s newest technology

  • Cut prices on older version of product by 33%

  • Endorsement contract with famous World Cup soccer athletes

  • Create multifunctional new product design team


Reverse Engineering – Your Rival’s Product


Value chain analysis

Ratio analysis

Benchmarking

Cost analysis

Trend analysis

Personality profiling

Wargaming or scenario planning

Competitive behavior analysis

Competitor Intelligence Pyramid


Track Existing Rivals

Anticipate New Rivals

Inform Strategy:

Identify own/competitor’s strengths/weaknesses

Early warning system

Plan of attack/retaliation

Competitor Intelligence Pyramid


The Cola Wars


Competitive Action Repertoire

The set of competitive actions carried out in a given time period

Coke’s Market Share

MKT

CAP

SIG

PROD

PRICE

MKT

MKT

PROD

Repertoire


Your Rival’s Competitive Actions

  • Contract with famous movie director, Spike Lee, for TV ad

  • Increase R&D budget by 30%

  • Buy warehouse facility near airport in Germany, Re-tool with robotic material handling system

  • License Oracle’s newest technology

  • Cut prices on older version of product by 33%

  • Endorsement contract with famous U.S. Olympic athletes

  • Create multifunctional new product design team

a

b

c

d

e


Competitive Dynamics Analysis

  • Observe competitive moves

  • Organize competitive moves

    • Action/response pairs

    • Action repertoires (year-end tallies)

    • Competitive attacks/sequences

  • Measurement/Analysis of Characteristics

    • Action pattern characteristics that improve:

      • Market share

      • Stock price

      • Profitability


Response

Action

Action-Reaction “Pairs”

Action

Pair 1

Action

Pair 2

Action

Pair 3

Action

Pair 4

Coca-Cola

d

d

c

d

Pepsi

a

c

a

e

  • Profits

  • Growth

  • Mkt. Share

time


Profits

Growth

Mkt. Share

Total Actions

Complexity

Action “Repertoires”

c

c

c

Coca-Cola

a

a

Year-End

Tallies

a

c

Pepsi

d

e

time


Strategy and Adaptive Maneuvering

8

7

6

5

4

3

2

1

  • Chess:

  • Epaulette’s Mate

  • Sicilian Defense

a b c d e f g h


Sequence Applications...

COMPUTER PROGRAM:

data actions2;

subj = _n_;

do i = 1 to max;

output = matrix;

end;

run;

DNA:

BOXING:

Jab...Jab…Uppercut

LANGUAGE:

qcheaTiueissesne.

hsiT si a cesneueq.

This is a sequence.

CAGTACATAGTACGATACGA

MUSIC:


Competitive Actions Over Time

Coke

Pepsi

a

a

a

b

b

b

c

c

c

d

d

e

e

d

c

e

a

a

b

a

b

c

d

e

c

b

Observed Sequence

Observed Sequence


Coke Strategic Non-Conformity

Coke

Industry Norm

a

a

a

b

b

b

c

c

c

d

d

e

e

d

c

e

a

a

b

a

b

c

d

e

c

b

Observed Sequence

Observed Sequence


Pepsi Strategic Conformity

Pepsi

Industry Norm

a

a

a

b

b

b

c

c

c

d

d

e

e

e

a

b

d

e

c

a

a

b

c

d

c

b

Observed Sequence

Observed Sequence


Coke Strategic Unpredictability

Coke in time1

Coke in time2

a

a

a

b

b

b

c

c

c

d

d

e

e

a

d

a

b

c

e

d

b

b

c

c

e

a

Observed Sequence

Observed Sequence


Pepsi Strategic Predictability

Pepsi in time1

Pepsi in time2

a

a

a

b

b

b

c

c

c

d

d

e

e

a

d

a

b

c

e

a

d

b

c

c

e

b

Observed Sequence

Observed Sequence


King of the Hill – Fizzy Beverages

Market

Share

Other ?

Coke

Pepsi

1950 1960 1970 1980 1990 2000


“Hardball” Competition

  • Total Actions

    • More actions are better

  • Average Response Time

    • Faster response time is better

  • Repertoire Complexity

    • Complex repertoire is better

  • Attack [Un-]Predictability

    • Unpredictability is better


Group Exercise: Coke vs. Pepsi

  • Total Actions

    • Count of total actions

  • Average Response Time

    • Avg. number of time units between last competitive move in Coke’s attack and Pepsi’s first competitive response, etc.

  • Repertoire Complexity

    • Extent to which entire pattern/repertoire is skewed/simple vs. balanced/complex

  • Attack [Un-]Predictability

    • Recognizable repetition or action combinations in the sequence of actions?


Scoring the Fight

Total Actions

Faster Responses

More Complex Repertoire

Unpredictable Attacks

CokePepsi

Who will win?


Rivals’ prior behavior

Patterns

Tendencies

Type & order of moves

Proactiveness

Reactiveness

Drivers of Behavior

Management orientation

Decision-making

Financial constraints

Industry characteristics

Implications for CI:Predict Future Behavior of Rivals


Implications for CI:Monitor Your Own Behavior

  • Objectively measures of competitive behavior

  • Safeguard against complacency, predictability, simplicity of your own company

  • Keep rivals off balance / disruption / guessing

  • What combinations of moves are effective? …which are ineffective? …smoke signals or bluffs?


ad
  • Login