Clone number in the collection
This presentation is the property of its rightful owner.
Sponsored Links
1 / 1

31 87 pSAT4.hspP. EGFP PowerPoint PPT Presentation


  • 74 Views
  • Uploaded on
  • Presentation posted in: General

Clone number in the collection. Clone number in the collection. Vector name. Insert template. 2 298 pSAT6.35SP.MCS.35ST. 31 87 pSAT4.hspP. EGFP. BamHI - EGFP -F SpeI - EGFP -R. CGATGAGGATCCGTGAGCAAGGGCGAGGAGC. GATACAACTAGTCTTGTACAGCTCGTCCATG. Restriction enzymes. PCR primers. BamHI

Download Presentation

31 87 pSAT4.hspP. EGFP

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


31 87 psat4 hspp egfp

Clone number in the collection

Clone number in the collection

Vector name

Insert template

2298 pSAT6.35SP.MCS.35ST

3187 pSAT4.hspP.EGFP

BamHI-EGFP-F

SpeI-EGFP-R

CGATGAGGATCCGTGAGCAAGGGCGAGGAGC

GATACAACTAGTCTTGTACAGCTCGTCCATG

Restriction enzymes

PCR primers

BamHI

SpeI

BamHI

SpeI

pSAT6.35SP.EGFP.35ST

Resulting clone


  • Login