Isolation and Characterization of
This presentation is the property of its rightful owner.
Sponsored Links
1 / 16

Isolation and Characterization of the Metallothionein Promoter in Artemia PowerPoint PPT Presentation


  • 155 Views
  • Uploaded on
  • Presentation posted in: General

Isolation and Characterization of the Metallothionein Promoter in Artemia. Background. metallothionein = MT metal-binding protein four isoforms identified in mammals: MT-I, MT-II, MT-III and MT-IV diverse functions -metal ion homeostasis

Download Presentation

Isolation and Characterization of the Metallothionein Promoter in Artemia

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Isolation and characterization of the metallothionein promoter in artemia

Isolation and Characterization of

the Metallothionein Promoter

in Artemia

Gwen Jordaan


Background

Background

metallothionein = MT

metal-binding protein

four isoforms identified in mammals: MT-I,

MT-II, MT-III and MT-IV

diverse functions -metal ion homeostasis

-heavy metal sequestration

-protection from oxidative damage

-metal reservoir

Gwen Jordaan


Metallothionein

Metallothionein

  • dumbbell shape, cysteine-rich

  •  domain and  domain

  • clusters of metal ions

www.unizh.ch/~mtpage/into.html

Gwen Jordaan


Metallothionein1

Metallothionein

  • Zinc-thiolate clusters

  • Eo very low

Fischer et al., Proc.Natl.Acad.Sci. 1998

Maret, W. Am.Soc.Nutr.Sci 2000

Gwen Jordaan


Metallothionein regulation

Metallothionein Regulation

regulation – transcriptional level

induction – metals, oxidants,cytokines, hormones

metal induction- metal responsive elements (MREs)

MREs- conserved core sequence TGC(G/A)CNC

metal transcription factor, MTF-1 regulates expression

- binding to MRE

- activity induced by metals but needs zinc to bind

to MRE

Gwen Jordaan


Metallothionein regulation1

Metallothionein Regulation

Gwen Jordaan


Artemia

Artemia

  • brine shrimp – Artemia salina

Nauplius

Adult

http://www.captain.at/artemia/

http://www.acuariolasmercedes.com/Guia-de-cuidado/artemia-salina-brine-shrimps-introducion-1.htm

Gwen Jordaan


Metallothionein2

Metallothionein

Why Artemia?

small, easy to grow, and relatively cheap to purchase

embryonic development extensively studied

biomarker for heavy metal contamination in aquatic

ecosystems

-phthalate ester embryotoxicity

four Artemia MT isoforms identified

coding region of one of the isoforms sequenced

Gwen Jordaan


Metallothionein3

Metallothionein

Goal: isolate and sequence the promoter region, ID

position and number of MREs, and determine

extent of promoter activity when induced by

heavy metals

- experiment design will determine if four

isoforms regulated by one promoter, or if each

isoform is regulated by its own promoter

Gwen Jordaan


Metallothionein4

Metallothionein

  • coding sequence of Artemia MT isoform

5’ATGGACTGCTGCAAGAACGGTTGCACCTGTGCCCCAAATTGCAAATGTGCC

Start asp cys cys lys asn gly cys thr cys ala pro asn cys lys cys ala

AAAGACTGCAAATGCTGCAAAGGTTGTGAGTGCAAAAGCAACCCAGAATGC

lys asp cys lys cys cys lys gly cys glu cys lys ser asp pro glu cys

AAATGTGAGAAGAACTGTTCATGCAACTCATGTGGTTGTCACTGA3’

lys cys glu lys asn cys ser cys asn ser cys gly cys hisStop

Gwen Jordaan


Methods and materials

Methods and Materials

Genomic DNA digested with restriction enzymes

DNA walking method- amplification of an unknown

sequence adjacent to a known sequence

-

  • touchdown PCR – annealing/extension temperature is

    higher than Tm of the primers

Gwen Jordaan


Methods and materials1

Methods and Materials

DNA walking

Clone into vector clone into GFP

reporter gene

Send for sequencing

generate MT promoter-

ID MREs GFP constructs

transfect into COS cells

treat with nM metal concentrations

for 24h incubation

measure fluorescence

Gwen Jordaan


Methods and materials2

Methods and Materials

  • MT-GFP constructs showing deletions

MT-GFP vector

GFP

Gwen Jordaan


Expected results

  • induction by Zn greater than Cd

  • extent of induction decreased as MREs removed

Expected Results

Gwen Jordaan


Future perspectives

Future Perspectives

  • 4 promoters for 4 isoforms or 1 promoter for 4 isoforms

    - expression is tissue-specific

    - differential expression due to environmental factors

  • cooperative interaction among MREs

  • promoter sequenced other regulatory elements can be

    identified and studied

    -ARE/USF – oxidative stress

Gwen Jordaan


Acknowledgements

Acknowledgements

Dr Acey (Research Mentor)

HHMI

Dr Mason (Instructor)

Gwen Jordaan


  • Login