60 likes | 234 Views
Cracking the Code. DNA. VC: Cracking the code. copied and read. RNA. translated. http://entomology.wisc.edu/~goodman/wgr...rch.html. PROTEIN. DNA COPIES ITSELF : Base pairings: A- T C – G DNA molecule unzips breaking the base pairs forming 2 sides. VC: DNA Replication
E N D
Cracking the Code DNA VC: Cracking the code copied and read RNA translated http://entomology.wisc.edu/~goodman/wgr...rch.html PROTEIN
DNA COPIES ITSELF:Base pairings: A- T C – GDNA moleculeunzips breaking the base pairs forming 2 sides VC: DNA Replication VC: How DNA copies itself
A: TACCGGATGCCAGATCAAATCWhat is the other side? Given the code of a DNA molecule, what would be the code of the new DNA strand? ATGGCCTACGGTCTAGTTTAG B: TACGGGGGCGTAACCACAACTWhat is the other side? ______________________________
2.CODE IS READ into RNA. The code of the new strand (DNA copy) is READwith theT replaced with a new base Uracil or U to make RNA. From #1: (DNA copy) ATGGCCTACGGTCTAGT T TAG AUGGCCUACGGUCUAGUUUAG A: ____________________________________ ATGCCCCCGCATTGGTGTTGA B: ____________________________________
3. RNA CODE IS TRANSLATED into PROTEINS (amino acids). RNA is small enough to leave the nucleus and go into cytoplasm= messenger. The RNA message is grouped into codons. (codon = 3 RNA nucleotide bases) AUG/GCC/UAC/GGU/CUA/GUU/UAG A: ____________________________________
Step 3 continued. Codons are translated into PROTEINS (Amino Acid) sequence AUG/ GCC/ UAC/ GGU/ CUA/ GUU/ UAG A: Methionine-Alanine-Tyrosine-Glycine- Leucine-Valine-Stop B: AUG CCC CCG CAU UGG UGU UGA