dnalc/resources/3d/13-transcription-advanced.html

1. Transcription http://www.dnalc.org/resources/3d/13-transcription-advanced.html mRNA Splicing http://www.dnalc.org/resources/3d/rna-splicing.html Translation http://www.dnalc.org/resources/3d/16-translation-advanced.html

3. REGULATION OF GENE EXPRESSION IN PROKARYOTES Even simple unicellular organisms must be able to turn genes on and off in response to changing environmental conditions ( for example available nutrients). • Single cell organisms • Relatively small genome (E. coli ~5 x 106 b.p., 4300 genes) • Polycistronic mRNAs • Jacob and Monod “The Operon Model”

4. Operons are clusters of genes for a metabolic pathway that are coordinately controlled (turned on or off). • Negative Control of transcription • “Repressible” type or “inducible” type • Regulatory genes are transcribed at low rates continuously. These regulatory gene products shut operons “off”.

5. Tryptophan Operon (“repressible type”)

6. If tryptophan is present the trp operon is shut “off.” The trp operon is an example of a repressible operon, one that is inhibited when a specific small molecule binds allosterically to a regulatory protein (repressor).

7. In contrast, an inducible operon is stimulated when a specific small molecule interacts with a regulatory protein.

8. When lactose is present in the cell, allolactase, an isomer of lactose, binds to the repressor. • This inactivates the repressor, and the lac operon can be transcribed.

9. Repressible enzymes generally function in anabolic pathways, synthesizing end products. • When the end product is present in sufficient quantities, the cell can allocate its resources to other uses. • Inducible enzymes usually function in catabolic pathways, digesting nutrients to simpler molecules. • By producing the appropriate enzymes only when the nutrient is available, the cell avoids making proteins that have nothing to do.

10. Positive gene control occurs when an activator molecule interacts directly with the genome to increase the level of transcription.

11. GENOME ORGANIZATION AND THE REGULATION OF GENE EXPRESSION IN EUKARYOTES • Human Genome ~3.5 x109 b.p. and ~25,000 genes • Segmented genome (chromosomes) • DNA highly associated with proteins

12. Interphase chromatin “Condensed” mitotic chromosome

13. Interphase chromosomes have areas that remain highly condensed, heterochromatin, and less compacted areas, euchromatin. • Only about 2-3% of the genome is genes • The other 97% ?

14. Interphase chromosomes have areas that remain highly condensed, heterochromatin, and less compacted areas, euchromatin. • Only about 3% of the genome is genes • The other 97% ? • Centromeres, teleomeres • Regulatory sequences • Repetitive • Tandem repeats (~15%) • Interspersed repeats (~25-40%) • Transposons

15. REGULATION OF EUKARYOTIC GENES • Like unicellular organisms, the tens of thousands of genes in the cells of multicellular eukaryotes are continually turned on and off in response to signals from their internal and external environments. • Gene expression must be controlled on a long-term basis during cellular differentiation, the divergence in form and function as cells specialize. • Highly specialized cells, like nerves or muscles, express only a tiny fraction of their genes.

16. These levels of control include chromatin packing, transcription, RNA processing, translation, and various alterations to the protein product.

17. CHROMATIN STRUCTURE • Chemical modifications of chromatin play a key role in chromatin structure and transcription regulation. • Modification of histones • -Methylation • -Acetylation

19. 5’GGCTCAATGCGCTATAAAGTCACCCGTAAATGCGTACTTG CAACGTTTAGCGCTTATGTTTTACCCCTATGAAGGGTAAGGGCGAGTTCCTTTATCGCTCGAACAGTCTGGGCCCTATTAGGCGTAGGCTAGCTTTTTGGCAAACAGCCCTGACCCTCTGCATATAGCTAAAA3’ • Determine the mRNA that would be produced from the above DNA (only one strand is shown). Transcription begins 25 nucleotides beyond the end of the TATA box. Red regions represent introns. • Determine the protein that would be translated from this mRNA.

20. Regulation at the level of transcription • Chromatin-modifying enzymes provide a coarse adjustment to gene expression by making a region of DNA either more available or less available for transcription. • Fine-tuning begins with the interaction of transcription factors with DNA sequences that control specific genes.

21. Organization of Eukaryotic Gene

24. POST-TRANSCRIPTIONAL GENE REGULATION • Gene expression may be blocked or stimulated by any post-transcriptional step. • By using regulatory mechanisms that operate after transcription, a cell can rapidly fine-tune gene expression in response to environmental changes without altering its transcriptional patterns.

25. RNA processing in the nucleus and the export of mRNA to the cytoplasm provide opportunities for gene regulation that are not available in bacteria. • In alternative RNA splicing, different mRNA molecules are produced from the sameprimary transcript,depending onwhich RNAsegments aretreated as exons and which as introns.

26. REGULATION OF mRNA STABILITY • The life span of a mRNA molecule is an important factor determining the pattern of protein synthesis. • Prokaryotic mRNA molecules may be degraded after only a few minutes. • Eukaryotic mRNAs endure typically for hours or even days or weeks. • For example, in red blood cells the mRNAs for the hemoglobin polypeptides are unusually stable and are translated repeatedly in these cells.

27. A common pathway of mRNA breakdown begins with enzymatic shortening of the poly(A) tail. • This triggers the enzymatic removal of the 5’ cap. • This is followed by rapid degradation of the mRNA by nucleases. • Nucleotide sequences in the untranslated trailer region at the 3’ end affect mRNA stability. • Transferring such a sequence from a short-lived mRNA to a stable mRNA results in quick mRNA degradation. • Removal of destabilizing element in c-fos proto-oncogene makes it oncogenic.

28. Micro RNAs- regulate gene expression RNAi : RNA Interference

29. TRANSLATIONAL CONTROL MECHANISMS • Translation of specific mRNAs can be blocked by regulatory proteins that bind to specific sequences or structures within the 5’ leader region of mRNA. • This prevents attachment to ribosomes. • Protein factors required to initiate translation in eukaryotes offer targets for simultaneously controlling translation of all the mRNA in a cell. • This allows the cell to shut down translation if environmental conditions are poor (for example, shortage of a key constituent) or until the appropriate conditions exist (for example, until after fertilization or during daylight in plants). • Specific shut down of viral mRNA translation in interferon treated cells. Posphoryation of eIF-2.

31. PROTEIN MODIFICATION • Finally, eukaryotic polypeptides must often be processed to yield functional proteins. • This may include cleavage, chemical modifications, and transport to the appropriate destination.

32. The cell limits the lifetimes of normal proteins by selective degradation. • Many proteins, like the cyclins in the cell cycle, must be short-lived to function appropriately. • Proteins intended for degradation are marked by the attachment of ubiquitin proteins. • Giant proteosomes recognize the ubiquitin and degrade the tagged protein.