1 / 19

Sickle Cell

Sickle Cell. Introduction. Sickle Cell Anemia is an inherited disorder that leads to the production of an abnormal hemoglobin - hemoglobin S- (HbS or HgbS). In the red blood cell (RBC), Occur by a mutation in the Hemoglobin Beta Gene which can be found in the chromosome 11.

kenny
Download Presentation

Sickle Cell

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Sickle Cell Mohammed laqqan

  2. Introduction Sickle Cell Anemia is an inherited disorder that leads to the production of an abnormal hemoglobin - hemoglobin S- (HbS or HgbS). In the red blood cell (RBC), Occur by a mutation in the Hemoglobin Beta Gene which can be found in the chromosome 11. This disease causes the body to make abnormally shapes red blood cells. A normal red blood cell is shaped as a round donut while the abnormal red blood cell has a “ C “ form. Mohammed laqqan

  3. Hemoglobin molecules in each red blood cell carry oxygen from the lungs to body organs and tissues and bring carbon dioxide back to the lungs. • In sickle cell anemia, the hemoglobin is defective. After hemoglobin molecules give up their oxygen, some may cluster together and form long, rod-like structures. These structures cause red blood cells to become stiff and assume a sickle shape. Mohammed laqqan

  4. Characters of Sickled Red Cell • Changing the shape of the RBC from a round disc to a characteristic crescent (sickle) shape. • Sickled red cells cannot squeeze through small blood vessels. • They stack up and cause blockages that deprive organs and tissues of oxygen-carrying blood. • Normal red blood cells live about 120 days in the bloodstream, but sickled red cells die after about 10 to 20 days. • The affected person can become anemic because the body cannot produce RBCs as fast as they are destroyed. Mohammed laqqan

  5. Inheritance • Sickle cell anemia is an autosomal recessive genetic disorder caused by a defect in the beta chain of globing. • Hemoglobin S differs from normal adult hemoglobin (hemoglobin A) only by a single amino acid substitution (a valine replacing a glutamine in the 6th position of the beta chain of globing). • When a person has two copies of the S gene (homozygous SS), he has sickle cell anemia. Mohammed laqqan

  6. Mutation found in Hemoglobin Sequence of normal hemoglobin DNA: CTGACTCCTGAGGAGAAGTCT GACTGAGGACTCCTCTTCAGA Amino acids: L T P E E K S Sequence found in sickling hemoglobin DNA: CTGACTCCTGTGGAGAAGTCT GACTGAGGACACCTCTTCAGA Amino acids: L T P V E K S Mohammed laqqan

  7. In sickle cell disease, as much as 80% to 100% of the hemoglobin may be HbS. • A person with one altered S gene will have sickle cell trait. • In those who have sickle cell trait, 20% to 40% of the hemoglobin is HbS. • The person does not generally have any symptoms or health problems but can pass the gene on to his children. Mohammed laqqan

  8. If each parent carries one sickle hemoglobin gene (S) and one normal gene (A), each child has a 25% chance of inheriting two defective genes and having sickle cell anemia. • 25% chance of inheriting two normal genes and not having the disease. • 50% chance of being an unaffected carrier like the parents. Mohammed laqqan

  9. Mohammed laqqan

  10. Pathophysiology • Normal hemoglobin exists as solitary units whether oxygenated or deoxygenated (upper panel). • In contrast, sickle hemoglobin molecules adhere when they are deoxygenated, forming sickle hemoglobin polymers ( lower panel). Mohammed laqqan

  11. Sickle Cell Hemoglobin's Stick Together Normal hemoglobin Sickle Cell hemoglobin No Oxygen No oxygen No Oxygen: stuck together No Oxygen: Separate Mohammed laqqan

  12. Normal red cells maintain their shape as they pass through the capillaries and release oxygen to the peripheral tissues (upper panel). • Hemoglobin polymers form in the sickle red cells with oxygen release, causing them to deform. • The deformed cells block the flow of cells and interrupt the delivery of oxygen to the tissues (lower panel). Mohammed laqqan

  13. Mohammed laqqan

  14. Sickle cell test • A sickle cell test is a blood test done to screen for sickle cell trait or sickle cell disease. • Sickle cell disease is an inherited blood disease that causes red blood cells to be deformed (sickle-shaped). • If the screening test is negative, it means that the gene for sickle cell trait is not present. • If the screening test is positive, then further haemoglobin testing must be performed to confirm whether one mutated gene or both are present. Mohammed laqqan

  15. Sickle cell test • Principle: • When a drop of blood is sealed between a cover slip and a slide, the decline in oxygen tension due to oxidative processes in the blood cells leads to sickling. • When we add a chemical reducing agents, Sodium dithionite or sodium metabisulfite. This rapidly reduces oxyhemoglobin to reduced hemoglobin, and this property suggested its use in testing erythrocytes for sickling. Mohammed laqqan

  16. Sodium Metabisulfite Method • Specimen: • Whole blood using heparin or EDTA. • Reagent and equipment: • Sodium Metabisulfite 2% (w/v ). • Petroleum jelly. • Cover glass. • Microscope. Mohammed laqqan

  17. Procedure • Place one drop of the blood to be tested in a glass slide. • Add 1- 2 drops of sodium metabisulfite to the drop of blood and mix well with an applicator stick. • Place a cover glass on top of the sample and press down lightly on it to remove any air bubbles and to form a thin layer of the mixture. Wipe of the excess sample. • Carefully rim the cover gloss with the petroleum jelly, completely sealing the mixture under the cover slip. • Examine the preparation for the present of sickle cells after one hour using 40 X objective. Mohammed laqqan

  18. Mohammed laqqan

  19. Solubility test • Principle: • Erythrocytes are lysed by saponin. • The released hemoglobin is reduced by sodium hydrosulfite in a concentrated phosphate buffer. • Under these conditions, reduced HbS is characterized by its very low solubility and the formation of crystals. • The presences of HbS or HbC are indicated by the turbid solutions. • The normal HbA under these same conditions results in a clear non-turbid solutions. Mohammed laqqan

More Related